Incidental Mutation 'R2911:Shcbp1l'
ID261224
Institutional Source Beutler Lab
Gene Symbol Shcbp1l
Ensembl Gene ENSMUSG00000042708
Gene NameShc SH2-domain binding protein 1-like
Synonyms1700012A16Rik
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153425162-153452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153428626 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 144 (L144I)
Ref Sequence ENSEMBL: ENSMUSP00000137625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042373] [ENSMUST00000136614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042373
AA Change: L144I

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036347
Gene: ENSMUSG00000042708
AA Change: L144I

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
CASH 362 522 2.85e-8 SMART
PbH1 479 500 2.3e3 SMART
PbH1 501 523 5.74e1 SMART
PbH1 524 557 2.3e3 SMART
PbH1 560 582 1.56e0 SMART
low complexity region 603 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136614
AA Change: L144I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137625
Gene: ENSMUSG00000042708
AA Change: L144I

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
Meta Mutation Damage Score 0.1445 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Src homology 2 domain-binding protein 1-like protein. The encoded protein interacts with heat shock 70 kDa protein 2 and may be involved in maintaining spindle integrity during meiosis. This gene is located in region of chromoso0me 1 encompassing a prostate cancer susceptibility locus. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with reduced sperm, increased male germ cell apoptosis and spindle instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Shcbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Shcbp1l APN 1 153435807 missense possibly damaging 0.79
IGL01067:Shcbp1l APN 1 153436024 missense possibly damaging 0.49
IGL02292:Shcbp1l APN 1 153436145 splice site probably benign
IGL02588:Shcbp1l APN 1 153428665 missense probably benign 0.05
IGL03220:Shcbp1l APN 1 153433165 splice site probably benign
R0467:Shcbp1l UTSW 1 153433182 missense probably damaging 1.00
R0534:Shcbp1l UTSW 1 153428568 missense possibly damaging 0.78
R1192:Shcbp1l UTSW 1 153425507 missense possibly damaging 0.60
R2878:Shcbp1l UTSW 1 153437518 splice site probably benign
R2910:Shcbp1l UTSW 1 153428626 missense probably damaging 0.98
R3080:Shcbp1l UTSW 1 153436037 missense possibly damaging 0.95
R3854:Shcbp1l UTSW 1 153452444 missense probably damaging 1.00
R7373:Shcbp1l UTSW 1 153425240 missense probably benign 0.07
R7793:Shcbp1l UTSW 1 153447825 missense probably benign 0.00
Z1176:Shcbp1l UTSW 1 153452274 missense probably damaging 1.00
Z1176:Shcbp1l UTSW 1 153452385 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTGTTTAAGGCAATATTGG -3'
(R):5'- CTGCCTGAGTACTACAGTTCC -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTTGGATCTCACAC -3'
(R):5'- GCCTGAGTACTACAGTTCCAGATG -3'
Posted On2015-01-23