Incidental Mutation 'R2911:Tgs1'
ID261235
Institutional Source Beutler Lab
Gene Symbol Tgs1
Ensembl Gene ENSMUSG00000028233
Gene Nametrimethylguanosine synthase 1
SynonymsNcoa6ip, Pimt, D4Ertd800e
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location3574875-3616619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3585616 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 164 (N164K)
Ref Sequence ENSEMBL: ENSMUSP00000054112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052712]
Predicted Effect probably benign
Transcript: ENSMUST00000052712
AA Change: N164K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054112
Gene: ENSMUSG00000028233
AA Change: N164K

DomainStartEndE-ValueType
low complexity region 113 130 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
Pfam:Met_10 661 798 3.4e-8 PFAM
Pfam:UPF0020 667 761 4.7e-7 PFAM
Pfam:Methyltransf_18 682 819 3.7e-9 PFAM
Pfam:Methyltransf_31 683 811 4.2e-10 PFAM
Pfam:Methyltransf_15 683 837 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132518
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display complete lethality around implantation with embryonic growth arrest, impaired hatching from the zona pellucida, and increased apoptosis. Null MEFs display G2 arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Tgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Tgs1 APN 4 3591292 missense possibly damaging 0.93
IGL01154:Tgs1 APN 4 3585473 nonsense probably null
IGL01554:Tgs1 APN 4 3593632 missense probably null 0.68
IGL01613:Tgs1 APN 4 3585183 missense possibly damaging 0.92
IGL02117:Tgs1 APN 4 3585836 missense probably damaging 1.00
IGL02259:Tgs1 APN 4 3604743 missense probably damaging 0.96
IGL02697:Tgs1 APN 4 3585564 missense probably benign 0.01
IGL02814:Tgs1 APN 4 3585719 missense probably damaging 1.00
IGL02962:Tgs1 APN 4 3586181 missense probably benign 0.04
IGL03223:Tgs1 APN 4 3591322 splice site probably benign
IGL03340:Tgs1 APN 4 3604813 missense probably benign 0.44
K2124:Tgs1 UTSW 4 3595547 missense probably benign 0.00
R0189:Tgs1 UTSW 4 3593620 missense probably benign 0.08
R0708:Tgs1 UTSW 4 3586152 missense probably benign 0.07
R1029:Tgs1 UTSW 4 3593471 missense probably damaging 0.98
R1446:Tgs1 UTSW 4 3604848 missense probably damaging 1.00
R1623:Tgs1 UTSW 4 3585964 missense probably benign
R1711:Tgs1 UTSW 4 3598658 missense probably damaging 1.00
R1889:Tgs1 UTSW 4 3614928 missense probably benign 0.31
R3695:Tgs1 UTSW 4 3604949 intron probably null
R4615:Tgs1 UTSW 4 3585156 missense probably damaging 1.00
R5460:Tgs1 UTSW 4 3586170 missense probably benign
R6088:Tgs1 UTSW 4 3595383 missense probably benign 0.06
R6442:Tgs1 UTSW 4 3604760 nonsense probably null
R7542:Tgs1 UTSW 4 3595439 missense probably benign 0.01
R7894:Tgs1 UTSW 4 3598652 missense probably benign 0.10
R7977:Tgs1 UTSW 4 3598652 missense probably benign 0.10
R7996:Tgs1 UTSW 4 3605842 missense probably damaging 1.00
X0023:Tgs1 UTSW 4 3585912 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAAATAGGCTCAAGCTTGTTACC -3'
(R):5'- TATCAGGGAGGTTCCAAGGC -3'

Sequencing Primer
(F):5'- AGGCTCAAGCTTGTTACCATTTATC -3'
(R):5'- CTCAGAAGACAGTGTCTGGTC -3'
Posted On2015-01-23