Incidental Mutation 'R2911:Spata21'
ID261239
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Namespermatogenesis associated 21
Synonyms
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141088333-141112760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141103082 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 288 (M288V)
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051907
AA Change: M288V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004
AA Change: M288V

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181353
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141111364 unclassified probably null
IGL02679:Spata21 APN 4 141111265 unclassified probably benign
R1772:Spata21 UTSW 4 141111296 missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141111381 missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141111405 missense probably damaging 0.99
R2015:Spata21 UTSW 4 141107329 nonsense probably null
R2093:Spata21 UTSW 4 141096966 missense probably benign 0.04
R4809:Spata21 UTSW 4 141097120 critical splice donor site probably null
R4897:Spata21 UTSW 4 141104950 missense probably damaging 0.99
R4907:Spata21 UTSW 4 141097121 critical splice donor site probably null
R4921:Spata21 UTSW 4 141112091 missense probably damaging 1.00
R5269:Spata21 UTSW 4 141103021 missense probably damaging 1.00
R5380:Spata21 UTSW 4 141107185 missense probably damaging 1.00
R5602:Spata21 UTSW 4 141096899 missense probably benign
R6982:Spata21 UTSW 4 141096873 missense possibly damaging 0.71
R7503:Spata21 UTSW 4 141095303 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGGTCACGCCATCTCTTG -3'
(R):5'- TGGAAGGTTCATGCAGGGTC -3'

Sequencing Primer
(F):5'- AGGACAGTCTGAGCACCC -3'
(R):5'- GTTCATGCAGGGTCAGAGG -3'
Posted On2015-01-23