Incidental Mutation 'R2911:Ythdc1'
ID261244
Institutional Source Beutler Lab
Gene Symbol Ythdc1
Ensembl Gene ENSMUSG00000035851
Gene NameYTH domain containing 1
SynonymsA730098D12Rik
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86804221-86836659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86816559 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 88 (S88P)
Ref Sequence ENSEMBL: ENSMUSP00000122491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038384] [ENSMUST00000119339] [ENSMUST00000120498] [ENSMUST00000156363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038384
AA Change: S76P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039133
Gene: ENSMUSG00000035851
AA Change: S76P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 356 494 5e-42 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 625 645 N/A INTRINSIC
low complexity region 682 736 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119339
AA Change: S76P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113000
Gene: ENSMUSG00000035851
AA Change: S76P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
Pfam:YTH 337 478 4.4e-44 PFAM
low complexity region 498 522 N/A INTRINSIC
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 619 N/A INTRINSIC
low complexity region 656 710 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120498
AA Change: S76P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113951
Gene: ENSMUSG00000035851
AA Change: S76P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 355 496 4.6e-44 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151489
Predicted Effect possibly damaging
Transcript: ENSMUST00000156363
AA Change: S88P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122491
Gene: ENSMUSG00000035851
AA Change: S88P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 237 261 8e-3 SMART
low complexity region 281 292 N/A INTRINSIC
Pfam:YTH 350 488 3e-42 PFAM
low complexity region 510 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198859
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Other mutations in Ythdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Ythdc1 APN 5 86831811 missense probably damaging 1.00
IGL02222:Ythdc1 APN 5 86828043 missense possibly damaging 0.72
R0091:Ythdc1 UTSW 5 86820701 intron probably benign
R0311:Ythdc1 UTSW 5 86835705 missense probably damaging 0.97
R0349:Ythdc1 UTSW 5 86835720 missense probably damaging 1.00
R0630:Ythdc1 UTSW 5 86809348 splice site probably benign
R1662:Ythdc1 UTSW 5 86828122 critical splice donor site probably null
R1907:Ythdc1 UTSW 5 86830630 missense probably damaging 1.00
R2100:Ythdc1 UTSW 5 86816685 missense possibly damaging 0.62
R3692:Ythdc1 UTSW 5 86822667 missense probably damaging 0.98
R4042:Ythdc1 UTSW 5 86816524 missense probably benign 0.03
R4398:Ythdc1 UTSW 5 86815654 missense possibly damaging 0.95
R4398:Ythdc1 UTSW 5 86835820 utr 3 prime probably benign
R4608:Ythdc1 UTSW 5 86822808 missense probably damaging 0.97
R4806:Ythdc1 UTSW 5 86822845 missense probably damaging 0.99
R5291:Ythdc1 UTSW 5 86835688 missense probably damaging 1.00
R5761:Ythdc1 UTSW 5 86835951 utr 3 prime probably benign
R6180:Ythdc1 UTSW 5 86828094 missense possibly damaging 0.91
R6249:Ythdc1 UTSW 5 86831956 missense possibly damaging 0.94
R6560:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R7145:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R8072:Ythdc1 UTSW 5 86821274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTTCAGCAGTTGGGAAGC -3'
(R):5'- CAGAATCCCTTTTCCGTAGACAAG -3'

Sequencing Primer
(F):5'- CAGCAGTTGGGAAGCAGTTTTG -3'
(R):5'- CATCTAGACGCTTGTTCC -3'
Posted On2015-01-23