Incidental Mutation 'R2911:Tac1'
ID261247
Institutional Source Beutler Lab
Gene Symbol Tac1
Ensembl Gene ENSMUSG00000061762
Gene Nametachykinin 1
SynonymsNkna, preprotachykinin A, PPT-A, PPTA, 4930528L02Rik, NK1, neurokinin A, neurokinin 1, substance P, SP, NK-1
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7554879-7565834 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 7559097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090679] [ENSMUST00000184986] [ENSMUST00000185130] [ENSMUST00000185187]
Predicted Effect probably benign
Transcript: ENSMUST00000090679
SMART Domains Protein: ENSMUSP00000088175
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 97 107 1.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184481
Predicted Effect probably null
Transcript: ENSMUST00000184986
SMART Domains Protein: ENSMUSP00000138818
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 82 92 1.36e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185130
Predicted Effect probably null
Transcript: ENSMUST00000185187
SMART Domains Protein: ENSMUSP00000139347
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 97 107 1.36e1 SMART
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of agonist-induced hyperalgesia and an impaired response to chemical irritation of the urinary tract. Mice homozygous for a different knock-out allele display hypoalgesia, and reduced anxiety- and depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Tac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Tac1 APN 6 7559119 unclassified probably null
IGL02830:Tac1 APN 6 7555650 missense probably benign 0.00
IGL02926:Tac1 APN 6 7562410 missense possibly damaging 0.95
R0189:Tac1 UTSW 6 7562424 missense probably damaging 1.00
R0265:Tac1 UTSW 6 7559165 splice site probably benign
R0612:Tac1 UTSW 6 7555653 missense probably damaging 1.00
R2910:Tac1 UTSW 6 7559097 critical splice acceptor site probably null
R4547:Tac1 UTSW 6 7557216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACAATATGGGTTTCAGCATG -3'
(R):5'- TATCAGTGCACTCGTGGCTAC -3'

Sequencing Primer
(F):5'- CATGGTTTGCAGGGCTTATATAAAG -3'
(R):5'- GGCTACAGACACTATGAACATTTGTC -3'
Posted On2015-01-23