Incidental Mutation 'R2911:Adam10'
ID261253
Institutional Source Beutler Lab
Gene Symbol Adam10
Ensembl Gene ENSMUSG00000054693
Gene Namea disintegrin and metallopeptidase domain 10
Synonymskuzbanian, 1700031C13Rik, kuz
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70678997-70780229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70718723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 91 (S91L)
Ref Sequence ENSEMBL: ENSMUSP00000117162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067880] [ENSMUST00000140205] [ENSMUST00000144537]
Predicted Effect probably benign
Transcript: ENSMUST00000067880
AA Change: S91L

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063839
Gene: ENSMUSG00000054693
AA Change: S91L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 27 156 7.5e-15 PFAM
Pfam:Reprolysin_5 219 434 1e-33 PFAM
Pfam:Reprolysin_4 219 453 2.1e-29 PFAM
Pfam:Reprolysin 221 457 6.1e-8 PFAM
Pfam:Reprolysin_2 240 447 6.5e-39 PFAM
Pfam:Reprolysin_3 244 395 4.6e-27 PFAM
DISIN 467 551 5.99e-23 SMART
transmembrane domain 675 697 N/A INTRINSIC
low complexity region 709 739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140205
AA Change: S91L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117162
Gene: ENSMUSG00000054693
AA Change: S91L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 156 5.8e-18 PFAM
Pfam:Reprolysin_5 219 434 2.6e-34 PFAM
Pfam:Reprolysin_4 219 453 4e-30 PFAM
Pfam:Reprolysin 221 457 4.4e-10 PFAM
Pfam:Reprolysin_2 240 447 5.1e-36 PFAM
Pfam:Reprolysin_3 244 395 1.7e-24 PFAM
DISIN 467 513 1.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144537
SMART Domains Protein: ENSMUSP00000116867
Gene: ENSMUSG00000054693

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Reprolysin_5 76 145 5.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system. [provided by RefSeq, May 2016]
PHENOTYPE: Targeted inactivation of this gene leads to embryonic lethality at E9.5. Embryos homozygous for a knock-out allele display decreased size and multiple abnormalities related to Notch signaling, including defects of the developing central nervous system, somites, and cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Adam10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Adam10 APN 9 70718746 missense possibly damaging 0.92
IGL00582:Adam10 APN 9 70766895 missense possibly damaging 0.54
IGL02021:Adam10 APN 9 70743909 missense possibly damaging 0.60
IGL02149:Adam10 APN 9 70703431 missense probably damaging 1.00
IGL03310:Adam10 APN 9 70778089 missense probably damaging 1.00
PIT4382001:Adam10 UTSW 9 70766081 missense probably damaging 1.00
R0110:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0469:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0510:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0555:Adam10 UTSW 9 70754234 missense probably damaging 1.00
R0671:Adam10 UTSW 9 70765941 splice site probably benign
R0735:Adam10 UTSW 9 70748251 missense possibly damaging 0.81
R0785:Adam10 UTSW 9 70767888 missense possibly damaging 0.86
R0881:Adam10 UTSW 9 70746237 missense probably damaging 1.00
R1019:Adam10 UTSW 9 70761640 missense probably benign 0.00
R1169:Adam10 UTSW 9 70746292 missense probably damaging 0.97
R1779:Adam10 UTSW 9 70776369 splice site probably benign
R2048:Adam10 UTSW 9 70740075 missense possibly damaging 0.89
R3890:Adam10 UTSW 9 70768854 missense probably benign 0.00
R4608:Adam10 UTSW 9 70743891 missense probably damaging 0.99
R4609:Adam10 UTSW 9 70740143 missense probably damaging 1.00
R4689:Adam10 UTSW 9 70765954 missense possibly damaging 0.51
R5135:Adam10 UTSW 9 70766074 missense probably damaging 1.00
R5496:Adam10 UTSW 9 70722739 missense probably damaging 1.00
R5499:Adam10 UTSW 9 70740117 missense probably benign 0.16
R6730:Adam10 UTSW 9 70740176 critical splice donor site probably null
R6825:Adam10 UTSW 9 70761602 missense probably damaging 1.00
R6987:Adam10 UTSW 9 70722696 missense probably benign
R7616:Adam10 UTSW 9 70722711 missense possibly damaging 0.81
R7829:Adam10 UTSW 9 70766927 nonsense probably null
R7908:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
R7989:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
X0020:Adam10 UTSW 9 70740143 missense probably damaging 1.00
X0064:Adam10 UTSW 9 70765952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGAATTGTGTTACACAGCCC -3'
(R):5'- ATGACAAGAAATTCTTCCTCTGCCAC -3'

Sequencing Primer
(F):5'- ATGAATTGTGTTACACAGCCCTTGTC -3'
(R):5'- GTCCAACTTACCATAAATATGTC -3'
Posted On2015-01-23