Incidental Mutation 'R2911:Clstn2'
ID261255
Institutional Source Beutler Lab
Gene Symbol Clstn2
Ensembl Gene ENSMUSG00000032452
Gene Namecalsyntenin 2
SynonymsCst-2, CSTN2, CS2, 2900042C18Rik
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2911 (G1)
Quality Score214
Status Not validated
Chromosome9
Chromosomal Location97444395-98033181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97532722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000124081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]
Predicted Effect probably damaging
Transcript: ENSMUST00000035027
AA Change: V373A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: V373A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
SCOP:d1a8d_1 358 538 5e-21 SMART
Blast:LamG 380 529 3e-41 BLAST
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162295
AA Change: V373A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: V373A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
Pfam:Laminin_G_3 356 533 1.4e-9 PFAM
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Clstn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Clstn2 APN 9 97582452 splice site probably benign
IGL00563:Clstn2 APN 9 97582452 splice site probably benign
IGL00733:Clstn2 APN 9 97483049 missense probably damaging 1.00
IGL01303:Clstn2 APN 9 97483075 nonsense probably null
IGL01935:Clstn2 APN 9 97463468 missense probably damaging 1.00
IGL02157:Clstn2 APN 9 97541875 missense probably benign
IGL02974:Clstn2 APN 9 97532707 missense probably damaging 1.00
IGL03164:Clstn2 APN 9 97799409 missense possibly damaging 0.50
IGL03298:Clstn2 APN 9 97456572 missense probably damaging 1.00
R0653:Clstn2 UTSW 9 97458204 missense probably damaging 1.00
R0845:Clstn2 UTSW 9 97570628 missense probably benign 0.39
R0992:Clstn2 UTSW 9 97445712 missense probably benign 0.00
R1105:Clstn2 UTSW 9 97583499 splice site probably null
R1112:Clstn2 UTSW 9 97458228 missense possibly damaging 0.92
R1264:Clstn2 UTSW 9 97457609 missense probably benign 0.28
R1275:Clstn2 UTSW 9 97457430 missense probably benign 0.00
R1329:Clstn2 UTSW 9 97458174 missense probably damaging 1.00
R1396:Clstn2 UTSW 9 97461393 missense probably benign 0.02
R1556:Clstn2 UTSW 9 97456505 missense probably benign 0.41
R1703:Clstn2 UTSW 9 97458237 missense possibly damaging 0.90
R1837:Clstn2 UTSW 9 97583540 missense probably benign 0.00
R3434:Clstn2 UTSW 9 97454715 missense probably benign 0.17
R3771:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3772:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3854:Clstn2 UTSW 9 97463595 nonsense probably null
R4049:Clstn2 UTSW 9 97457560 missense possibly damaging 0.59
R4334:Clstn2 UTSW 9 97463528 missense probably damaging 1.00
R4705:Clstn2 UTSW 9 97463559 missense possibly damaging 0.95
R4755:Clstn2 UTSW 9 97445673 missense probably benign 0.01
R4884:Clstn2 UTSW 9 97799395 missense probably damaging 1.00
R5017:Clstn2 UTSW 9 97483086 missense probably damaging 1.00
R5076:Clstn2 UTSW 9 97483079 missense probably damaging 1.00
R5122:Clstn2 UTSW 9 97461421 missense probably damaging 1.00
R5155:Clstn2 UTSW 9 97456431 missense probably benign 0.02
R5560:Clstn2 UTSW 9 97469819 missense possibly damaging 0.95
R6009:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6011:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6029:Clstn2 UTSW 9 97456581 missense probably benign 0.00
R6093:Clstn2 UTSW 9 97458210 missense probably damaging 1.00
R6284:Clstn2 UTSW 9 97454674 missense probably benign
R6676:Clstn2 UTSW 9 97461531 missense probably damaging 1.00
R6902:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6946:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6966:Clstn2 UTSW 9 97526406 nonsense probably null
R7329:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7330:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7382:Clstn2 UTSW 9 97799398 nonsense probably null
R7410:Clstn2 UTSW 9 97541867 missense probably benign 0.06
R7549:Clstn2 UTSW 9 97582544 missense probably benign 0.01
R7879:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R7962:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R8070:Clstn2 UTSW 9 97799470 missense possibly damaging 0.79
X0027:Clstn2 UTSW 9 97526399 missense probably damaging 1.00
Z1177:Clstn2 UTSW 9 97461356 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCACCTGTTAGCTTCCAC -3'
(R):5'- GGAATAACCACTGTGCTTCCATC -3'

Sequencing Primer
(F):5'- TTGCCATGAAAAGATGCCATG -3'
(R):5'- AATAACCACTGTGCTTCCATCTCTTC -3'
Posted On2015-01-23