Incidental Mutation 'R2911:Lcp2'
ID261257
Institutional Source Beutler Lab
Gene Symbol Lcp2
Ensembl Gene ENSMUSG00000002699
Gene Namelymphocyte cytosolic protein 2
Synonymstwm, SLP76, SLP-76
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location34046920-34092295 bp(+) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) G to A at 34068970 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000052413] [ENSMUST00000109329] [ENSMUST00000109329]
Predicted Effect probably null
Transcript: ENSMUST00000052413
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000052413
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109329
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109329
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141450
Predicted Effect probably null
Transcript: ENSMUST00000169878
SMART Domains Protein: ENSMUSP00000126796
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.87e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 399 411 N/A INTRINSIC
SH2 420 511 4.44e-25 SMART
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Lcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Lcp2 APN 11 34047345 start gained probably benign
IGL01730:Lcp2 APN 11 34050943 missense possibly damaging 0.91
IGL02174:Lcp2 APN 11 34050966 splice site probably benign
IGL02228:Lcp2 APN 11 34047424 missense probably damaging 1.00
IGL02814:Lcp2 APN 11 34071033 missense probably damaging 1.00
R0142:Lcp2 UTSW 11 34082418 missense probably damaging 0.97
R0277:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0281:Lcp2 UTSW 11 34069854 splice site probably benign
R0323:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0437:Lcp2 UTSW 11 34087229 missense probably benign 0.00
R0632:Lcp2 UTSW 11 34082426 missense possibly damaging 0.87
R1479:Lcp2 UTSW 11 34075068 missense probably benign 0.01
R1570:Lcp2 UTSW 11 34089601 missense probably benign 0.07
R1744:Lcp2 UTSW 11 34069911 splice site probably null
R2212:Lcp2 UTSW 11 34070995 missense probably benign 0.14
R2910:Lcp2 UTSW 11 34068970 unclassified probably null
R3196:Lcp2 UTSW 11 34090670 missense probably benign 0.05
R4012:Lcp2 UTSW 11 34068439 missense probably damaging 1.00
R4411:Lcp2 UTSW 11 34087173 unclassified probably benign
R4417:Lcp2 UTSW 11 34050917 missense probably benign 0.27
R4423:Lcp2 UTSW 11 34078226 intron probably benign
R4718:Lcp2 UTSW 11 34070992 missense probably benign 0.09
R5090:Lcp2 UTSW 11 34089725 nonsense probably null
R6347:Lcp2 UTSW 11 34082501 missense probably benign 0.10
R7315:Lcp2 UTSW 11 34069906 critical splice donor site probably null
R7694:Lcp2 UTSW 11 34050924 missense probably benign 0.16
R7910:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
R7991:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTCTCTAGAAGCTGGGAG -3'
(R):5'- AGTCTCTGCAGGATACCTCTAG -3'

Sequencing Primer
(F):5'- CTCTAGAAGCTGGGAGGCAGC -3'
(R):5'- CAGGATACCTCTAGAGTGGATTC -3'
Posted On2015-01-23