Incidental Mutation 'R2911:Rin3'
ID261263
Institutional Source Beutler Lab
Gene Symbol Rin3
Ensembl Gene ENSMUSG00000044456
Gene NameRas and Rab interactor 3
Synonyms
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102283048-102390855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102373584 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 598 (S598A)
Ref Sequence ENSEMBL: ENSMUSP00000122646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056950] [ENSMUST00000133820]
Predicted Effect probably benign
Transcript: ENSMUST00000056950
AA Change: S678A

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: S678A

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133820
AA Change: S598A

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456
AA Change: S598A

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Rin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Rin3 APN 12 102373603 missense probably damaging 1.00
IGL01521:Rin3 APN 12 102369048 missense probably benign 0.00
PIT4495001:Rin3 UTSW 12 102369036 missense probably benign 0.02
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0504:Rin3 UTSW 12 102387564 nonsense probably null
R0699:Rin3 UTSW 12 102369575 missense probably damaging 0.98
R1499:Rin3 UTSW 12 102368759 missense unknown
R1733:Rin3 UTSW 12 102369330 nonsense probably null
R1743:Rin3 UTSW 12 102390096 missense possibly damaging 0.87
R2961:Rin3 UTSW 12 102313046 nonsense probably null
R3153:Rin3 UTSW 12 102368541 missense unknown
R3932:Rin3 UTSW 12 102390083 missense probably damaging 0.98
R4498:Rin3 UTSW 12 102369680 missense probably damaging 1.00
R4803:Rin3 UTSW 12 102361383 intron probably benign
R4985:Rin3 UTSW 12 102368562 missense unknown
R5300:Rin3 UTSW 12 102369670 missense probably benign 0.29
R5363:Rin3 UTSW 12 102325834 missense probably damaging 0.97
R5414:Rin3 UTSW 12 102389857 nonsense probably null
R5458:Rin3 UTSW 12 102373716 missense probably damaging 0.99
R5503:Rin3 UTSW 12 102313055 missense probably benign 0.17
R5534:Rin3 UTSW 12 102387632 missense probably damaging 1.00
R5599:Rin3 UTSW 12 102389929 missense probably damaging 1.00
R5752:Rin3 UTSW 12 102313119 start gained probably benign
R5874:Rin3 UTSW 12 102389843 missense probably damaging 1.00
R6467:Rin3 UTSW 12 102369325 missense probably benign 0.06
R7250:Rin3 UTSW 12 102368634 missense unknown
R7264:Rin3 UTSW 12 102390115 missense probably benign 0.01
R7514:Rin3 UTSW 12 102369650 nonsense probably null
R7534:Rin3 UTSW 12 102350941 missense unknown
R7837:Rin3 UTSW 12 102368765 missense unknown
R7875:Rin3 UTSW 12 102369476 missense probably damaging 1.00
R7920:Rin3 UTSW 12 102368765 missense unknown
R7958:Rin3 UTSW 12 102369476 missense probably damaging 1.00
R8014:Rin3 UTSW 12 102361371 nonsense probably null
Z1177:Rin3 UTSW 12 102325862 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGAAGAGCACTACATTGG -3'
(R):5'- GTCAGCTTCTGCAGGATCTTC -3'

Sequencing Primer
(F):5'- GAGCACTACATTGGAGAGACC -3'
(R):5'- GGATCTTCTCCATGACAGCCAC -3'
Posted On2015-01-23