Mutagenetix > Incidental Mutations

Incidental Mutation 'R0334:Tnks'

26127

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

038543-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0334 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 34853259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 753 (K753*)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000033929
AA Change: K753*

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: K753*

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209904

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,617,129		probably benign	Het
Aggf1	T	C	13: 95,371,597	N87S	probably benign	Het
Ap2b1	T	C	11: 83,367,874		probably benign	Het
Arfgef3	A	G	10: 18,592,281	Y1724H	probably damaging	Het
Arhgef10l	G	A	4: 140,583,926	Q243*	probably null	Het
Atp8a2	A	T	14: 59,691,512	F1031Y	probably damaging	Het
Bmp8b	A	G	4: 123,114,760		probably null	Het
Brinp2	G	T	1: 158,295,585	T37K	probably benign	Het
Bsph1	T	A	7: 13,450,939	L9*	probably null	Het
C6	T	G	15: 4,755,367	N238K	probably benign	Het
Cbs	T	C	17: 31,619,156	D373G	probably damaging	Het
Clec4a3	T	C	6: 122,969,370	F191S	possibly damaging	Het
Cpz	A	G	5: 35,503,681	V530A	probably damaging	Het
Ctsc	G	T	7: 88,278,342	S47I	possibly damaging	Het
Cyp7b1	T	G	3: 18,103,796	Y53S	probably damaging	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Defb4	T	C	8: 19,201,204	I29T	probably benign	Het
Disc1	A	T	8: 125,261,097		probably null	Het
Dnah2	A	G	11: 69,436,836	M3429T	probably damaging	Het
Dnah7a	A	T	1: 53,433,054	I3518N	possibly damaging	Het
Dnah8	A	T	17: 30,871,351	H4609L	probably damaging	Het
Evi5	C	A	5: 107,820,535	C182F	probably damaging	Het
Fam149b	G	A	14: 20,363,424	R237H	probably damaging	Het
Fut8	T	A	12: 77,393,762	D174E	possibly damaging	Het
Ghr	T	C	15: 3,341,098		probably benign	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm12794	T	C	4: 101,941,584	F251L	probably benign	Het
Gm8882	T	A	6: 132,364,058	Q17L	unknown	Het
Gm9573	A	G	17: 35,622,722		probably benign	Het
Gpr176	T	C	2: 118,279,708	S357G	probably benign	Het
Grwd1	A	T	7: 45,827,177		probably null	Het
H2-T24	A	G	17: 36,014,880	V273A	possibly damaging	Het
Hdac4	A	C	1: 91,956,038		probably benign	Het
Herc3	A	G	6: 58,918,817	T1017A	probably damaging	Het
Hsd11b1	T	C	1: 193,242,168		probably benign	Het
Igsf23	T	C	7: 19,941,753	S143G	probably benign	Het
Kbtbd12	T	A	6: 88,617,906	Y314F	probably damaging	Het
Kcnmb2	A	G	3: 32,198,359		probably null	Het
Kdm5b	A	G	1: 134,604,522	I479M	probably damaging	Het
Kidins220	A	G	12: 25,008,069	T600A	probably damaging	Het
Mrgprb2	A	C	7: 48,552,329	I216S	probably damaging	Het
Myo1g	A	G	11: 6,511,084		probably benign	Het
Nrxn3	T	C	12: 89,813,642		probably null	Het
Olfr706	A	G	7: 106,886,415	V134A	probably benign	Het
Olfr921	A	T	9: 38,775,239		probably null	Het
Olfr943	A	G	9: 39,184,684	I169V	probably benign	Het
Pdia5	A	T	16: 35,464,390	S66T	possibly damaging	Het
Plec	T	C	15: 76,178,006	E2604G	probably damaging	Het
Plekha6	G	T	1: 133,282,180	A654S	probably benign	Het
Pnpla2	G	A	7: 141,459,520		probably null	Het
Prkdc	A	G	16: 15,736,799	D2128G	probably benign	Het
Rabggta	A	T	14: 55,720,811	L131Q	probably damaging	Het
Rbks	A	T	5: 31,624,519	Y312*	probably null	Het
Rnf139	A	G	15: 58,899,473	Y449C	probably damaging	Het
Sbno1	A	G	5: 124,386,868	V1058A	possibly damaging	Het
Sema3a	A	T	5: 13,557,301	N321I	probably damaging	Het
Slit3	T	A	11: 35,579,101	V310E	probably damaging	Het
Slitrk5	T	C	14: 111,680,824	S627P	probably benign	Het
Stat2	T	A	10: 128,277,867	F172I	probably damaging	Het
Tchh	C	A	3: 93,445,616	R788S	unknown	Het
Trank1	T	A	9: 111,365,353	V815D	probably benign	Het
Trank1	T	A	9: 111,392,940	I2915N	probably damaging	Het
Trpc6	T	C	9: 8,610,343	S271P	probably damaging	Het
Trpm5	T	C	7: 143,086,876	Q213R	probably benign	Het
Ulk3	C	T	9: 57,594,227		probably benign	Het
Usp31	T	C	7: 121,658,962	D694G	probably damaging	Het
Wnt3a	A	G	11: 59,256,318	S181P	probably damaging	Het
Yipf3	T	C	17: 46,248,312	F22S	possibly damaging	Het
Zbtb40	A	T	4: 136,986,556	H1094Q	probably damaging	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGATGGAAAAGTTCCTACGGCCAC -3'
(R):5'- AGGTTTGGGGCAGAGTCTCACATAG -3'

Sequencing Primer
(F):5'- AAAAGTTCCTACGGCCACTTTTC -3'
(R):5'- ctgacctcctgcctttacc -3'

Posted On

2013-04-16