Incidental Mutation 'R2911:Ndc80'
ID261272
Institutional Source Beutler Lab
Gene Symbol Ndc80
Ensembl Gene ENSMUSG00000024056
Gene NameNDC80 kinetochore complex component
Synonyms2610020P18Rik, Kntc2, HEC1
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71496100-71526857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71500376 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 528 (S528R)
Ref Sequence ENSEMBL: ENSMUSP00000024851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024851]
Predicted Effect probably benign
Transcript: ENSMUST00000024851
AA Change: S528R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024851
Gene: ENSMUSG00000024056
AA Change: S528R

DomainStartEndE-ValueType
Pfam:Ndc80_HEC 51 204 3.6e-54 PFAM
coiled coil region 249 423 N/A INTRINSIC
coiled coil region 458 599 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the NDC80 kinetochore complex. The encoded protein consists of an N-terminal microtubule binding domain and a C-terminal coiled-coiled domain that interacts with other components of the complex. This protein functions to organize and stabilize microtubule-kinetochore interactions and is required for proper chromosome segregation. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Ndc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Ndc80 APN 17 71499325 missense probably benign 0.23
IGL01691:Ndc80 APN 17 71508639 missense possibly damaging 0.72
IGL02175:Ndc80 APN 17 71511419 missense probably benign 0.00
IGL02293:Ndc80 APN 17 71514278 missense probably damaging 1.00
IGL03086:Ndc80 APN 17 71520925 missense probably benign 0.01
R0730:Ndc80 UTSW 17 71496246 missense probably benign
R1749:Ndc80 UTSW 17 71501555 missense probably benign 0.11
R2061:Ndc80 UTSW 17 71514218 missense probably benign 0.17
R2099:Ndc80 UTSW 17 71504778 missense probably benign 0.00
R4598:Ndc80 UTSW 17 71521068 missense probably damaging 1.00
R4599:Ndc80 UTSW 17 71521068 missense probably damaging 1.00
R4678:Ndc80 UTSW 17 71520758 critical splice donor site probably null
R4775:Ndc80 UTSW 17 71514270 missense probably damaging 1.00
R5029:Ndc80 UTSW 17 71508765 missense probably benign 0.01
R5283:Ndc80 UTSW 17 71521135 missense probably benign 0.03
R5356:Ndc80 UTSW 17 71521108 missense possibly damaging 0.76
R5412:Ndc80 UTSW 17 71514231 missense probably damaging 1.00
R5542:Ndc80 UTSW 17 71500281 missense probably benign 0.21
R6031:Ndc80 UTSW 17 71511488 missense probably benign 0.00
R6031:Ndc80 UTSW 17 71511488 missense probably benign 0.00
R6051:Ndc80 UTSW 17 71517578 missense probably benign 0.14
R6680:Ndc80 UTSW 17 71517545 missense probably null 0.46
R7658:Ndc80 UTSW 17 71508663 missense probably damaging 0.96
R7716:Ndc80 UTSW 17 71523594 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CCTCATTCTTTATATCCCAAATGGC -3'
(R):5'- GTACAGCACTCCCCAGGGG -3'

Sequencing Primer
(F):5'- TTGGCCTTGAACTCACAGAG -3'
(R):5'- CCCAGGGGAGCAGCTAAG -3'
Posted On2015-01-23