Incidental Mutation 'R2911:Reep2'
ID261273
Institutional Source Beutler Lab
Gene Symbol Reep2
Ensembl Gene ENSMUSG00000038555
Gene Namereceptor accessory protein 2
Synonyms
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R2911 (G1)
Quality Score217
Status Not validated
Chromosome18
Chromosomal Location34840589-34847463 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 34845690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043484]
Predicted Effect probably null
Transcript: ENSMUST00000043484
SMART Domains Protein: ENSMUSP00000036065
Gene: ENSMUSG00000038555

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.4e-36 PFAM
low complexity region 129 138 N/A INTRINSIC
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Reep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Reep2 APN 18 34846249 missense probably benign
IGL02244:Reep2 APN 18 34840754 unclassified probably benign
R0624:Reep2 UTSW 18 34840771 missense probably benign 0.02
R2005:Reep2 UTSW 18 34845621 missense probably damaging 1.00
R2910:Reep2 UTSW 18 34845690 critical splice donor site probably null
R5642:Reep2 UTSW 18 34846218 missense probably benign
R6709:Reep2 UTSW 18 34846210 missense probably benign 0.10
R7029:Reep2 UTSW 18 34845289 missense probably null 0.22
Predicted Primers PCR Primer
(F):5'- TTTCCTATGGGTGGCCAGAG -3'
(R):5'- TCTGGTCAGATGAGGAAACTGAC -3'

Sequencing Primer
(F):5'- TGCAGTAACCTGGCAGAGC -3'
(R):5'- TCAGATGAGGAAACTGACTAGAC -3'
Posted On2015-01-23