Incidental Mutation 'R2912:Bmpr1b'
ID261291
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141880378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 41 (D41G)
Ref Sequence ENSEMBL: ENSMUSP00000117478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
Predicted Effect probably benign
Transcript: ENSMUST00000029948
AA Change: D41G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098568
AA Change: D41G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106230
AA Change: D41G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106232
AA Change: D41G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: D41G

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
AA Change: D41G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430
AA Change: D41G

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
PIT4366001:Bmpr1b UTSW 3 141880463 missense probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCATTGACAAGGAGCCTGAG -3'
(R):5'- AAGGCTGTCCTAACCCTCATCC -3'

Sequencing Primer
(F):5'- TTCATTGACAAGGAGCCTGAGATCTG -3'
(R):5'- ACCCTCATCCATTATTCTTTTCAGAG -3'
Posted On2015-01-23