Incidental Mutation 'R2912:Emc1'
ID261295
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139365260 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 504 (S504P)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: S501P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: S501P

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: S504P

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: S504P

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: S504P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: S504P

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAAGGTCCTTCAGGAG -3'
(R):5'- ACAAATGCTGACTCGTGACAG -3'

Sequencing Primer
(F):5'- TCCTTCAGGAGAGGGAGAGGC -3'
(R):5'- GATCAATTCTATCCTCGAAAACTGG -3'
Posted On2015-01-23