Incidental Mutation 'R2912:Zfp467'
ID261298
Institutional Source Beutler Lab
Gene Symbol Zfp467
Ensembl Gene ENSMUSG00000068551
Gene Namezinc finger protein 467
SynonymsEZI, MNCb-3350, 1190001I08Rik
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48427697-48445825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48439076 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 214 (R214L)
Ref Sequence ENSEMBL: ENSMUSP00000110208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101443] [ENSMUST00000114556] [ENSMUST00000114558] [ENSMUST00000114559] [ENSMUST00000114560] [ENSMUST00000114561] [ENSMUST00000114563] [ENSMUST00000114564] [ENSMUST00000114566] [ENSMUST00000141449]
Predicted Effect probably benign
Transcript: ENSMUST00000101443
Predicted Effect probably benign
Transcript: ENSMUST00000114556
Predicted Effect probably benign
Transcript: ENSMUST00000114558
Predicted Effect probably benign
Transcript: ENSMUST00000114559
Predicted Effect possibly damaging
Transcript: ENSMUST00000114560
AA Change: R214L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110207
Gene: ENSMUSG00000068551
AA Change: R214L

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114561
AA Change: R214L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110208
Gene: ENSMUSG00000068551
AA Change: R214L

DomainStartEndE-ValueType
low complexity region 98 110 N/A INTRINSIC
ZnF_C2H2 160 182 1.26e-2 SMART
ZnF_C2H2 188 210 1.67e-2 SMART
ZnF_C2H2 216 238 2.12e-4 SMART
ZnF_C2H2 244 266 5.9e-3 SMART
ZnF_C2H2 272 294 1.47e-3 SMART
ZnF_C2H2 300 322 1.82e-3 SMART
ZnF_C2H2 355 377 9.58e-3 SMART
ZnF_C2H2 430 452 7.26e-3 SMART
ZnF_C2H2 458 480 1.56e-2 SMART
ZnF_C2H2 486 508 1.18e-2 SMART
ZnF_C2H2 514 536 3.11e-2 SMART
ZnF_C2H2 542 564 2.43e-4 SMART
low complexity region 567 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114563
Predicted Effect probably benign
Transcript: ENSMUST00000114564
Predicted Effect probably benign
Transcript: ENSMUST00000114566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140198
Predicted Effect probably benign
Transcript: ENSMUST00000141449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein whose function has not yet been elucidated in humans. However, the mouse ortholog of this protein enhances adipocyte differentiation and suppresses osteoblast differentiation in bone marrow. The mouse protein also is a transcription factor for several genes and can help recruit histone deacetylase complexes. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Zfp467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Zfp467 UTSW 6 48438681 missense probably benign 0.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R0234:Zfp467 UTSW 6 48438755 missense probably damaging 1.00
R1509:Zfp467 UTSW 6 48438687 missense possibly damaging 0.95
R1517:Zfp467 UTSW 6 48438236 missense probably damaging 1.00
R1656:Zfp467 UTSW 6 48439079 missense possibly damaging 0.87
R2131:Zfp467 UTSW 6 48442661 missense probably damaging 0.98
R4696:Zfp467 UTSW 6 48439357 unclassified probably benign
R4714:Zfp467 UTSW 6 48427817 missense unknown
R4993:Zfp467 UTSW 6 48439029 missense probably damaging 1.00
R7038:Zfp467 UTSW 6 48438138 missense probably damaging 1.00
R7224:Zfp467 UTSW 6 48444969 critical splice donor site probably null
R7855:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
R7938:Zfp467 UTSW 6 48439181 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGATGCGTCTTCTTGCGG -3'
(R):5'- GATCCCTGAGAAGCCTTATGG -3'

Sequencing Primer
(F):5'- GAAACGTTTCTCGCATTCGG -3'
(R):5'- CCTTATGGCTGCGAGGAATGC -3'
Posted On2015-01-23