Incidental Mutation 'R2912:Med17'
ID261306
Institutional Source Beutler Lab
Gene Symbol Med17
Ensembl Gene ENSMUSG00000031935
Gene Namemediator complex subunit 17
SynonymsTrap80, C330002H14Rik, Crsp6
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15260351-15279931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15275914 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 188 (L188P)
Ref Sequence ENSEMBL: ENSMUSP00000034411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411] [ENSMUST00000216406]
Predicted Effect probably damaging
Transcript: ENSMUST00000034411
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935
AA Change: L188P

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213356
Predicted Effect probably benign
Transcript: ENSMUST00000216406
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Med17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Med17 APN 9 15279621 missense probably benign 0.19
IGL02263:Med17 APN 9 15267476 missense probably damaging 0.98
IGL02390:Med17 APN 9 15277667 nonsense probably null
IGL02391:Med17 APN 9 15277667 nonsense probably null
IGL02392:Med17 APN 9 15277667 nonsense probably null
IGL02393:Med17 APN 9 15277667 nonsense probably null
IGL02591:Med17 APN 9 15270361 missense probably damaging 1.00
IGL02635:Med17 APN 9 15274549 missense probably damaging 1.00
IGL02745:Med17 APN 9 15265346 splice site probably benign
IGL02815:Med17 APN 9 15262267 missense probably damaging 1.00
IGL02897:Med17 APN 9 15267534 missense probably damaging 1.00
R1448:Med17 UTSW 9 15275843 splice site probably null
R2937:Med17 UTSW 9 15275891 missense probably damaging 0.99
R3715:Med17 UTSW 9 15263766 splice site probably benign
R4175:Med17 UTSW 9 15267469 missense possibly damaging 0.93
R4557:Med17 UTSW 9 15271697 missense possibly damaging 0.86
R4701:Med17 UTSW 9 15270360 missense probably damaging 1.00
R4865:Med17 UTSW 9 15265372 nonsense probably null
R5169:Med17 UTSW 9 15277604 missense probably benign 0.03
R5510:Med17 UTSW 9 15270404 missense probably benign
R6326:Med17 UTSW 9 15279558 missense probably benign 0.32
R6393:Med17 UTSW 9 15274583 missense probably damaging 1.00
R6598:Med17 UTSW 9 15271700 missense probably benign 0.29
R7722:Med17 UTSW 9 15271691 missense probably benign 0.01
R8181:Med17 UTSW 9 15277632 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AATGGTTTGGGCTTACAGGTAAAG -3'
(R):5'- GCCTCATGCTTGCATGGTAC -3'

Sequencing Primer
(F):5'- GATCTGTACCTGCACTTC -3'
(R):5'- TGGTACACCCCTTGCCAG -3'
Posted On2015-01-23