Incidental Mutation 'R2912:Panx2'
ID261321
Institutional Source Beutler Lab
Gene Symbol Panx2
Ensembl Gene ENSMUSG00000058441
Gene Namepannexin 2
Synonyms
MMRRC Submission 040499-MU
Accession Numbers

Genbank: NM_001002005; MGI: 1890615

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89059734-89073567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89069821 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 660 (I660V)
Ref Sequence ENSEMBL: ENSMUSP00000124354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161372] [ENSMUST00000162424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159412
Predicted Effect unknown
Transcript: ENSMUST00000159960
AA Change: I50V
Predicted Effect silent
Transcript: ENSMUST00000161372
SMART Domains Protein: ENSMUSP00000125514
Gene: ENSMUSG00000058441

DomainStartEndE-ValueType
Pfam:Innexin 48 274 2.1e-11 PFAM
transmembrane domain 302 324 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161735
Predicted Effect probably benign
Transcript: ENSMUST00000162424
AA Change: I660V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124354
Gene: ENSMUSG00000058441
AA Change: I660V

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Innexin 49 263 5.6e-18 PFAM
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 490 505 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162579
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 1 are abundantly expressed in central nervous system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 1 may form cell type-specific gap junctions with distinct properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a slight protection from the neurological defects induced by ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Slc9a3r2 C T 17: 24,642,241 G71S probably damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Panx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Panx2 APN 15 89068767 missense probably damaging 0.99
IGL02112:Panx2 APN 15 89069569 missense probably benign
IGL03384:Panx2 APN 15 89068119 missense possibly damaging 0.85
F6893:Panx2 UTSW 15 89068010 missense probably damaging 1.00
R0453:Panx2 UTSW 15 89068407 missense probably damaging 1.00
R1990:Panx2 UTSW 15 89069738 missense possibly damaging 0.95
R3826:Panx2 UTSW 15 89068461 missense probably damaging 1.00
R4424:Panx2 UTSW 15 89068220 missense probably benign 0.02
R4593:Panx2 UTSW 15 89067915 missense probably damaging 1.00
R5176:Panx2 UTSW 15 89060228 missense probably damaging 1.00
R5328:Panx2 UTSW 15 89068095 missense probably damaging 0.99
R5333:Panx2 UTSW 15 89068539 missense possibly damaging 0.58
R5381:Panx2 UTSW 15 89060230 missense probably damaging 1.00
R5412:Panx2 UTSW 15 89068932 missense possibly damaging 0.79
R5450:Panx2 UTSW 15 89068959 missense possibly damaging 0.74
R5989:Panx2 UTSW 15 89060252 missense probably damaging 1.00
R6255:Panx2 UTSW 15 89067618 missense probably damaging 1.00
R7585:Panx2 UTSW 15 89067966 missense probably damaging 1.00
R7685:Panx2 UTSW 15 89067770 missense possibly damaging 0.65
R7899:Panx2 UTSW 15 89068733 missense possibly damaging 0.74
R8030:Panx2 UTSW 15 89068079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCATTCCATGTCTGCTCAC -3'
(R):5'- CACTTGTGGATGCCATGGTG -3'

Sequencing Primer
(F):5'- GCCGCTGCTTCCCTGTC -3'
(R):5'- CGTGGCATGCAGACAGG -3'
Posted On2015-01-23