Incidental Mutation 'R2912:Slc9a3r2'
ID261325
Institutional Source Beutler Lab
Gene Symbol Slc9a3r2
Ensembl Gene ENSMUSG00000002504
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2
SynonymsSip1, 0610011L07Rik, Sryip1, Nherf2, Octs2, Tka-1, Sip-1, E3karp, 2010007A20Rik, 1200011K07Rik
MMRRC Submission 040499-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2912 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24639282-24650305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24642241 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 71 (G71S)
Ref Sequence ENSEMBL: ENSMUSP00000019684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572] [ENSMUST00000019684] [ENSMUST00000047611]
Predicted Effect probably damaging
Transcript: ENSMUST00000002572
AA Change: G182S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504
AA Change: G182S

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019684
AA Change: G71S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019684
Gene: ENSMUSG00000002504
AA Change: G71S

DomainStartEndE-ValueType
PDZ 48 120 8.79e-20 SMART
Pfam:EBP50_C-term 186 226 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047611
SMART Domains Protein: ENSMUSP00000047413
Gene: ENSMUSG00000041429

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 24 37 N/A INTRINSIC
low complexity region 55 68 N/A INTRINSIC
ENDO3c 126 276 1.06e-58 SMART
FES 277 297 4.82e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal and display normal cAMP- and cGMP-activated CFTR transepithelial chloride transport and bicarbonate secretion in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A T 11: 69,130,040 K197M probably damaging Het
Asxl2 A G 12: 3,474,517 K182E probably benign Het
Birc6 A G 17: 74,692,206 D4643G probably damaging Het
Bmpr1b T C 3: 141,880,378 D41G probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dhx29 A G 13: 112,935,575 E251G probably damaging Het
Dnajc27 C T 12: 4,096,280 S103L probably damaging Het
Dync1li1 T G 9: 114,715,675 N348K probably benign Het
Emc1 T C 4: 139,365,260 S504P possibly damaging Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam71a T C 1: 191,163,228 N406S probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Kcnq2 A G 2: 181,081,774 V603A probably damaging Het
Lama2 T C 10: 27,000,803 S2716G probably benign Het
Lax1 A G 1: 133,684,053 V48A possibly damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Med17 A G 9: 15,275,914 L188P probably damaging Het
Mfsd5 A G 15: 102,281,308 T372A probably benign Het
Mrgprb5 T C 7: 48,168,067 S307G probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Nrg1 A G 8: 31,818,567 S474P probably damaging Het
Nup210 T G 6: 91,026,974 D644A probably damaging Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Olfr1328 A G 4: 118,934,701 I47T probably benign Het
Olfr954 T C 9: 39,462,216 Y259H probably damaging Het
Panx2 A G 15: 89,069,821 I660V probably benign Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Prx C T 7: 27,516,229 P52S probably damaging Het
Ptprf A G 4: 118,248,980 S206P probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rfx6 A G 10: 51,718,130 D382G probably damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Trank1 T C 9: 111,392,483 S2763P probably damaging Het
Vmn1r42 T C 6: 89,844,706 M294V probably benign Het
Zfp467 C A 6: 48,439,076 R214L possibly damaging Het
Zfp750 C A 11: 121,512,327 A532S probably benign Het
Zscan4d G A 7: 11,162,687 P252L probably benign Het
Other mutations in Slc9a3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02676:Slc9a3r2 APN 17 24641956 missense probably damaging 1.00
R1843:Slc9a3r2 UTSW 17 24641719 missense possibly damaging 0.75
R2199:Slc9a3r2 UTSW 17 24640596 missense probably null 0.37
R4774:Slc9a3r2 UTSW 17 24644899 start codon destroyed probably null 0.01
R5352:Slc9a3r2 UTSW 17 24642255 missense probably damaging 1.00
R5356:Slc9a3r2 UTSW 17 24641971 missense probably damaging 1.00
R5562:Slc9a3r2 UTSW 17 24641824 missense probably benign 0.06
R5841:Slc9a3r2 UTSW 17 24644877 missense probably benign
R7231:Slc9a3r2 UTSW 17 24650104 missense probably damaging 1.00
R7338:Slc9a3r2 UTSW 17 24650208 start gained probably benign
R7539:Slc9a3r2 UTSW 17 24641899 missense probably damaging 0.99
R8276:Slc9a3r2 UTSW 17 24642260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATTCATCGAAGCCACCAGC -3'
(R):5'- ATGAAACCTGGGATTGGTTCC -3'

Sequencing Primer
(F):5'- CAGCAGCCAAAGAAGCAAG -3'
(R):5'- AAACCTGGGATTGGTTCCTTAGAGC -3'
Posted On2015-01-23