Incidental Mutation 'R2898:Stk36'
ID 261331
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Name serine/threonine kinase 36
Synonyms 1700112N14Rik, Fused
MMRRC Submission 040486-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74640604-74676053 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74671984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 895 (S895T)
Ref Sequence ENSEMBL: ENSMUSP00000120020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
AlphaFold Q69ZM6
Predicted Effect probably null
Transcript: ENSMUST00000087183
AA Change: S897T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: S897T

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087186
AA Change: S769T
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: S769T

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect probably null
Transcript: ENSMUST00000148456
AA Change: S895T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: S895T

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155473
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 77,413,868 (GRCm39) Q198* probably null Het
Acap3 C T 4: 155,987,916 (GRCm39) R547C possibly damaging Het
Acap3 G C 4: 155,989,388 (GRCm39) probably null Het
Adcy6 A G 15: 98,491,369 (GRCm39) S1075P probably damaging Het
Ankk1 T A 9: 49,333,122 (GRCm39) T121S probably benign Het
Bnc2 T C 4: 84,211,152 (GRCm39) I406V probably damaging Het
Bnipl T A 3: 95,150,360 (GRCm39) H219L probably benign Het
Brwd1 C A 16: 95,867,300 (GRCm39) M178I probably damaging Het
Cep192 T A 18: 67,988,341 (GRCm39) probably null Het
Chd5 T C 4: 152,456,572 (GRCm39) F970L probably damaging Het
Cit A G 5: 116,012,037 (GRCm39) probably null Het
Coq9 T C 8: 95,579,752 (GRCm39) Y236H probably damaging Het
Cxcr2 T C 1: 74,198,130 (GRCm39) V208A probably benign Het
Dnah10 G A 5: 124,894,734 (GRCm39) R3433H probably damaging Het
Dnmt3b G T 2: 153,509,550 (GRCm39) V268L possibly damaging Het
Fbxw21 T C 9: 108,985,404 (GRCm39) T125A possibly damaging Het
Fzd9 T G 5: 135,278,700 (GRCm39) D395A probably damaging Het
Gfm2 T C 13: 97,309,469 (GRCm39) V642A possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Hid1 A G 11: 115,241,356 (GRCm39) S645P probably benign Het
Hmgxb3 C T 18: 61,288,368 (GRCm39) V500M probably benign Het
Hnf1a C T 5: 115,098,106 (GRCm39) W165* probably null Het
Hsd3b1 A T 3: 98,760,623 (GRCm39) C123S probably benign Het
Inpp4a A T 1: 37,405,675 (GRCm39) H148L probably benign Het
Itpr2 C T 6: 146,074,839 (GRCm39) R2338Q probably benign Het
Itpr2 A T 6: 146,224,667 (GRCm39) I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Lmo7 A G 14: 102,114,350 (GRCm39) T31A possibly damaging Het
Lrrc15 C T 16: 30,092,604 (GRCm39) R245H probably benign Het
Lrriq1 T C 10: 103,063,111 (GRCm39) N65S probably damaging Het
Mpp4 T C 1: 59,183,853 (GRCm39) I296V probably benign Het
Myo6 T A 9: 80,176,893 (GRCm39) probably null Het
Myo7a G T 7: 97,703,631 (GRCm39) Y2003* probably null Het
Myo7a T C 7: 97,746,413 (GRCm39) N246D probably damaging Het
Ndrg4 A G 8: 96,405,014 (GRCm39) probably null Het
Neu2 A G 1: 87,522,782 (GRCm39) S72G probably benign Het
Or51g1 T A 7: 102,634,084 (GRCm39) I96F probably benign Het
Or8b1c T C 9: 38,384,271 (GRCm39) V76A probably damaging Het
Pcdhb1 A G 18: 37,399,516 (GRCm39) Y489C probably damaging Het
Ppp1r10 A G 17: 36,239,784 (GRCm39) K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 (GRCm39) T371I probably benign Het
Prpf8 A T 11: 75,386,860 (GRCm39) T1102S probably benign Het
Ric8b T G 10: 84,783,761 (GRCm39) D206E probably benign Het
Sacm1l T C 9: 123,389,666 (GRCm39) probably null Het
Sema6c C A 3: 95,080,129 (GRCm39) L776M probably damaging Het
Serpinb8 A G 1: 107,534,776 (GRCm39) T32A unknown Het
Sh2b3 A T 5: 121,967,111 (GRCm39) M1K probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spty2d1 T A 7: 46,643,100 (GRCm39) M664L unknown Het
Sycp3 G A 10: 88,308,544 (GRCm39) E205K possibly damaging Het
Taok3 A G 5: 117,338,134 (GRCm39) probably null Het
Tasor2 T C 13: 3,635,122 (GRCm39) N562D possibly damaging Het
Tbc1d16 A T 11: 119,048,654 (GRCm39) I333N probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thumpd2 C T 17: 81,351,557 (GRCm39) W288* probably null Het
Tnks2 T C 19: 36,849,990 (GRCm39) probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpm1 T C 9: 66,938,322 (GRCm39) D254G probably damaging Het
Usp53 A T 3: 122,751,223 (GRCm39) L278* probably null Het
Zfp37 C T 4: 62,110,014 (GRCm39) G350D probably damaging Het
Zfp777 C T 6: 48,002,594 (GRCm39) E543K probably damaging Het
Zfp81 A T 17: 33,553,274 (GRCm39) C513* probably null Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74,673,861 (GRCm39) missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74,673,244 (GRCm39) missense probably benign
IGL00792:Stk36 APN 1 74,650,276 (GRCm39) missense probably benign 0.01
IGL00941:Stk36 APN 1 74,663,093 (GRCm39) missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74,664,769 (GRCm39) missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74,672,797 (GRCm39) missense probably benign 0.03
IGL02143:Stk36 APN 1 74,655,728 (GRCm39) splice site probably benign
IGL02223:Stk36 APN 1 74,662,496 (GRCm39) missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74,661,414 (GRCm39) missense probably benign 0.13
IGL02618:Stk36 APN 1 74,670,834 (GRCm39) splice site probably benign
IGL02655:Stk36 APN 1 74,673,694 (GRCm39) missense probably damaging 1.00
IGL02993:Stk36 APN 1 74,661,446 (GRCm39) missense probably benign 0.05
IGL03125:Stk36 APN 1 74,662,472 (GRCm39) missense probably damaging 1.00
IGL03242:Stk36 APN 1 74,662,511 (GRCm39) missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74,672,779 (GRCm39) missense probably damaging 0.99
R0377:Stk36 UTSW 1 74,651,889 (GRCm39) missense probably benign
R0464:Stk36 UTSW 1 74,650,331 (GRCm39) missense probably damaging 0.98
R0520:Stk36 UTSW 1 74,641,365 (GRCm39) unclassified probably benign
R0551:Stk36 UTSW 1 74,655,780 (GRCm39) missense probably benign 0.00
R1118:Stk36 UTSW 1 74,671,925 (GRCm39) missense probably benign 0.29
R1119:Stk36 UTSW 1 74,671,925 (GRCm39) missense probably benign 0.29
R1471:Stk36 UTSW 1 74,650,314 (GRCm39) missense probably benign 0.14
R1915:Stk36 UTSW 1 74,673,346 (GRCm39) missense probably benign 0.08
R2159:Stk36 UTSW 1 74,673,896 (GRCm39) missense probably benign 0.00
R2290:Stk36 UTSW 1 74,665,303 (GRCm39) splice site probably benign
R2897:Stk36 UTSW 1 74,671,984 (GRCm39) missense probably null
R4032:Stk36 UTSW 1 74,665,207 (GRCm39) missense probably benign
R4353:Stk36 UTSW 1 74,671,966 (GRCm39) missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74,673,344 (GRCm39) missense probably benign 0.22
R4753:Stk36 UTSW 1 74,665,255 (GRCm39) missense probably benign 0.05
R4891:Stk36 UTSW 1 74,642,415 (GRCm39) missense probably damaging 1.00
R5068:Stk36 UTSW 1 74,661,504 (GRCm39) missense probably benign 0.00
R5115:Stk36 UTSW 1 74,674,986 (GRCm39) missense probably damaging 1.00
R5266:Stk36 UTSW 1 74,650,317 (GRCm39) missense probably benign
R5412:Stk36 UTSW 1 74,644,615 (GRCm39) splice site probably null
R5533:Stk36 UTSW 1 74,665,750 (GRCm39) missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74,644,584 (GRCm39) missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74,673,388 (GRCm39) missense probably benign 0.00
R6208:Stk36 UTSW 1 74,650,591 (GRCm39) missense probably benign 0.03
R6497:Stk36 UTSW 1 74,642,391 (GRCm39) missense probably damaging 1.00
R6805:Stk36 UTSW 1 74,661,398 (GRCm39) missense probably benign
R7064:Stk36 UTSW 1 74,649,979 (GRCm39) missense probably damaging 1.00
R7102:Stk36 UTSW 1 74,661,382 (GRCm39) missense probably benign 0.10
R7393:Stk36 UTSW 1 74,650,352 (GRCm39) nonsense probably null
R7408:Stk36 UTSW 1 74,672,725 (GRCm39) missense probably damaging 1.00
R7471:Stk36 UTSW 1 74,673,479 (GRCm39) missense unknown
R7816:Stk36 UTSW 1 74,650,328 (GRCm39) nonsense probably null
R8017:Stk36 UTSW 1 74,651,925 (GRCm39) missense probably benign
R8019:Stk36 UTSW 1 74,651,925 (GRCm39) missense probably benign
R8104:Stk36 UTSW 1 74,665,756 (GRCm39) missense probably benign 0.26
R8381:Stk36 UTSW 1 74,672,333 (GRCm39) missense probably benign
R8526:Stk36 UTSW 1 74,673,703 (GRCm39) missense probably benign 0.00
R8681:Stk36 UTSW 1 74,661,392 (GRCm39) missense probably damaging 0.99
R9320:Stk36 UTSW 1 74,655,793 (GRCm39) missense possibly damaging 0.64
R9436:Stk36 UTSW 1 74,650,272 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAAAGGATGGTTTCTGTGACTC -3'
(R):5'- TGGTGAGCAGCTCCATCATAG -3'

Sequencing Primer
(F):5'- CTCTGTGTCCAGGATAGAGATAAC -3'
(R):5'- GAGCAGCTCCATCATAGTCCCTG -3'
Posted On 2015-01-23