Incidental Mutation 'R2898:Shroom3'
ID 261344
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 040486-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 77,413,868 (GRCm39) Q198* probably null Het
Acap3 C T 4: 155,987,916 (GRCm39) R547C possibly damaging Het
Acap3 G C 4: 155,989,388 (GRCm39) probably null Het
Adcy6 A G 15: 98,491,369 (GRCm39) S1075P probably damaging Het
Ankk1 T A 9: 49,333,122 (GRCm39) T121S probably benign Het
Bnc2 T C 4: 84,211,152 (GRCm39) I406V probably damaging Het
Bnipl T A 3: 95,150,360 (GRCm39) H219L probably benign Het
Brwd1 C A 16: 95,867,300 (GRCm39) M178I probably damaging Het
Cep192 T A 18: 67,988,341 (GRCm39) probably null Het
Chd5 T C 4: 152,456,572 (GRCm39) F970L probably damaging Het
Cit A G 5: 116,012,037 (GRCm39) probably null Het
Coq9 T C 8: 95,579,752 (GRCm39) Y236H probably damaging Het
Cxcr2 T C 1: 74,198,130 (GRCm39) V208A probably benign Het
Dnah10 G A 5: 124,894,734 (GRCm39) R3433H probably damaging Het
Dnmt3b G T 2: 153,509,550 (GRCm39) V268L possibly damaging Het
Fbxw21 T C 9: 108,985,404 (GRCm39) T125A possibly damaging Het
Fzd9 T G 5: 135,278,700 (GRCm39) D395A probably damaging Het
Gfm2 T C 13: 97,309,469 (GRCm39) V642A possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Hid1 A G 11: 115,241,356 (GRCm39) S645P probably benign Het
Hmgxb3 C T 18: 61,288,368 (GRCm39) V500M probably benign Het
Hnf1a C T 5: 115,098,106 (GRCm39) W165* probably null Het
Hsd3b1 A T 3: 98,760,623 (GRCm39) C123S probably benign Het
Inpp4a A T 1: 37,405,675 (GRCm39) H148L probably benign Het
Itpr2 C T 6: 146,074,839 (GRCm39) R2338Q probably benign Het
Itpr2 A T 6: 146,224,667 (GRCm39) I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Lmo7 A G 14: 102,114,350 (GRCm39) T31A possibly damaging Het
Lrrc15 C T 16: 30,092,604 (GRCm39) R245H probably benign Het
Lrriq1 T C 10: 103,063,111 (GRCm39) N65S probably damaging Het
Mpp4 T C 1: 59,183,853 (GRCm39) I296V probably benign Het
Myo6 T A 9: 80,176,893 (GRCm39) probably null Het
Myo7a G T 7: 97,703,631 (GRCm39) Y2003* probably null Het
Myo7a T C 7: 97,746,413 (GRCm39) N246D probably damaging Het
Ndrg4 A G 8: 96,405,014 (GRCm39) probably null Het
Neu2 A G 1: 87,522,782 (GRCm39) S72G probably benign Het
Or51g1 T A 7: 102,634,084 (GRCm39) I96F probably benign Het
Or8b1c T C 9: 38,384,271 (GRCm39) V76A probably damaging Het
Pcdhb1 A G 18: 37,399,516 (GRCm39) Y489C probably damaging Het
Ppp1r10 A G 17: 36,239,784 (GRCm39) K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 (GRCm39) T371I probably benign Het
Prpf8 A T 11: 75,386,860 (GRCm39) T1102S probably benign Het
Ric8b T G 10: 84,783,761 (GRCm39) D206E probably benign Het
Sacm1l T C 9: 123,389,666 (GRCm39) probably null Het
Sema6c C A 3: 95,080,129 (GRCm39) L776M probably damaging Het
Serpinb8 A G 1: 107,534,776 (GRCm39) T32A unknown Het
Sh2b3 A T 5: 121,967,111 (GRCm39) M1K probably null Het
Spty2d1 T A 7: 46,643,100 (GRCm39) M664L unknown Het
Stk36 T A 1: 74,671,984 (GRCm39) S895T probably null Het
Sycp3 G A 10: 88,308,544 (GRCm39) E205K possibly damaging Het
Taok3 A G 5: 117,338,134 (GRCm39) probably null Het
Tasor2 T C 13: 3,635,122 (GRCm39) N562D possibly damaging Het
Tbc1d16 A T 11: 119,048,654 (GRCm39) I333N probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thumpd2 C T 17: 81,351,557 (GRCm39) W288* probably null Het
Tnks2 T C 19: 36,849,990 (GRCm39) probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpm1 T C 9: 66,938,322 (GRCm39) D254G probably damaging Het
Usp53 A T 3: 122,751,223 (GRCm39) L278* probably null Het
Zfp37 C T 4: 62,110,014 (GRCm39) G350D probably damaging Het
Zfp777 C T 6: 48,002,594 (GRCm39) E543K probably damaging Het
Zfp81 A T 17: 33,553,274 (GRCm39) C513* probably null Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- CCTGTGTCTTAACTGTCAGAACGG -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- GTGTCTTAACTGTCAGAACGGTAACC -3'
Posted On 2015-01-23