Incidental Mutation 'R2898:Fzd9'
ID 261350
Institutional Source Beutler Lab
Gene Symbol Fzd9
Ensembl Gene ENSMUSG00000049551
Gene Name frizzled class receptor 9
Synonyms mfz9, frizzled 9
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 135248938-135251230 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 135249846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 395 (D395A)
Ref Sequence ENSEMBL: ENSMUSP00000053551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
AlphaFold Q9R216
Predicted Effect probably benign
Transcript: ENSMUST00000002825
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062572
AA Change: D395A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551
AA Change: D395A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele exhibit immune system abnormalities while another null allele causes neurological abnormalities. A third null mutation results in growth retardation and abnormalities in bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Fzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Fzd9 APN 5 135249469 missense probably damaging 1.00
IGL01446:Fzd9 APN 5 135250566 missense probably damaging 1.00
IGL02510:Fzd9 APN 5 135249615 missense probably damaging 1.00
alexei UTSW 5 135250630 missense probably damaging 1.00
Nicholas UTSW 5 135250324 missense possibly damaging 0.54
R0308:Fzd9 UTSW 5 135249406 missense probably damaging 0.97
R0417:Fzd9 UTSW 5 135249619 missense probably damaging 0.99
R1563:Fzd9 UTSW 5 135250554 missense probably damaging 0.96
R1638:Fzd9 UTSW 5 135249748 missense probably damaging 1.00
R1840:Fzd9 UTSW 5 135249571 missense probably benign
R2046:Fzd9 UTSW 5 135249684 missense probably damaging 1.00
R2268:Fzd9 UTSW 5 135250294 missense probably damaging 1.00
R4078:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4079:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4576:Fzd9 UTSW 5 135250312 missense probably damaging 1.00
R4662:Fzd9 UTSW 5 135249621 missense probably damaging 1.00
R4956:Fzd9 UTSW 5 135249942 missense probably damaging 1.00
R5096:Fzd9 UTSW 5 135249859 missense probably damaging 0.96
R5227:Fzd9 UTSW 5 135249606 missense probably benign 0.06
R5452:Fzd9 UTSW 5 135250860 missense probably damaging 1.00
R5475:Fzd9 UTSW 5 135250269 splice site probably null
R5888:Fzd9 UTSW 5 135249463 splice site probably null
R5914:Fzd9 UTSW 5 135249345 missense probably benign
R7148:Fzd9 UTSW 5 135249690 missense probably benign 0.40
R7544:Fzd9 UTSW 5 135249862 missense probably damaging 1.00
R7638:Fzd9 UTSW 5 135250630 missense probably damaging 1.00
R8672:Fzd9 UTSW 5 135249670 missense probably benign 0.02
R8893:Fzd9 UTSW 5 135250324 missense possibly damaging 0.54
R8927:Fzd9 UTSW 5 135249735 missense probably damaging 1.00
R8928:Fzd9 UTSW 5 135249735 missense probably damaging 1.00
R9234:Fzd9 UTSW 5 135250686 missense probably damaging 0.99
R9240:Fzd9 UTSW 5 135249958 missense probably damaging 1.00
X0063:Fzd9 UTSW 5 135249721 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGGCACTGTGTAAAGGATGG -3'
(R):5'- ATGGCCAGCTCACTTTGGTG -3'

Sequencing Primer
(F):5'- GGAAAAGACTCCGATTTTGACC -3'
(R):5'- TTGACTCTAACCTGGTTCCTGG -3'
Posted On 2015-01-23