Incidental Mutation 'R2898:Myo7a'
ID 261359
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Name myosin VIIA
Synonyms nmf371, USH1B, polka, Hdb, Myo7
MMRRC Submission 040486-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 97700267-97768731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97746413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 246 (N246D)
Ref Sequence ENSEMBL: ENSMUSP00000102739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627] [ENSMUST00000205746]
AlphaFold P97479
Predicted Effect probably damaging
Transcript: ENSMUST00000084979
AA Change: N240D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: N240D

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: N246D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: N246D

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
AA Change: N251D

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: N251D

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
AA Change: N251D

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: N251D

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149079
Predicted Effect possibly damaging
Transcript: ENSMUST00000205746
AA Change: N240D

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153657
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 77,413,868 (GRCm39) Q198* probably null Het
Acap3 C T 4: 155,987,916 (GRCm39) R547C possibly damaging Het
Acap3 G C 4: 155,989,388 (GRCm39) probably null Het
Adcy6 A G 15: 98,491,369 (GRCm39) S1075P probably damaging Het
Ankk1 T A 9: 49,333,122 (GRCm39) T121S probably benign Het
Bnc2 T C 4: 84,211,152 (GRCm39) I406V probably damaging Het
Bnipl T A 3: 95,150,360 (GRCm39) H219L probably benign Het
Brwd1 C A 16: 95,867,300 (GRCm39) M178I probably damaging Het
Cep192 T A 18: 67,988,341 (GRCm39) probably null Het
Chd5 T C 4: 152,456,572 (GRCm39) F970L probably damaging Het
Cit A G 5: 116,012,037 (GRCm39) probably null Het
Coq9 T C 8: 95,579,752 (GRCm39) Y236H probably damaging Het
Cxcr2 T C 1: 74,198,130 (GRCm39) V208A probably benign Het
Dnah10 G A 5: 124,894,734 (GRCm39) R3433H probably damaging Het
Dnmt3b G T 2: 153,509,550 (GRCm39) V268L possibly damaging Het
Fbxw21 T C 9: 108,985,404 (GRCm39) T125A possibly damaging Het
Fzd9 T G 5: 135,278,700 (GRCm39) D395A probably damaging Het
Gfm2 T C 13: 97,309,469 (GRCm39) V642A possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Hid1 A G 11: 115,241,356 (GRCm39) S645P probably benign Het
Hmgxb3 C T 18: 61,288,368 (GRCm39) V500M probably benign Het
Hnf1a C T 5: 115,098,106 (GRCm39) W165* probably null Het
Hsd3b1 A T 3: 98,760,623 (GRCm39) C123S probably benign Het
Inpp4a A T 1: 37,405,675 (GRCm39) H148L probably benign Het
Itpr2 C T 6: 146,074,839 (GRCm39) R2338Q probably benign Het
Itpr2 A T 6: 146,224,667 (GRCm39) I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Lmo7 A G 14: 102,114,350 (GRCm39) T31A possibly damaging Het
Lrrc15 C T 16: 30,092,604 (GRCm39) R245H probably benign Het
Lrriq1 T C 10: 103,063,111 (GRCm39) N65S probably damaging Het
Mpp4 T C 1: 59,183,853 (GRCm39) I296V probably benign Het
Myo6 T A 9: 80,176,893 (GRCm39) probably null Het
Ndrg4 A G 8: 96,405,014 (GRCm39) probably null Het
Neu2 A G 1: 87,522,782 (GRCm39) S72G probably benign Het
Or51g1 T A 7: 102,634,084 (GRCm39) I96F probably benign Het
Or8b1c T C 9: 38,384,271 (GRCm39) V76A probably damaging Het
Pcdhb1 A G 18: 37,399,516 (GRCm39) Y489C probably damaging Het
Ppp1r10 A G 17: 36,239,784 (GRCm39) K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 (GRCm39) T371I probably benign Het
Prpf8 A T 11: 75,386,860 (GRCm39) T1102S probably benign Het
Ric8b T G 10: 84,783,761 (GRCm39) D206E probably benign Het
Sacm1l T C 9: 123,389,666 (GRCm39) probably null Het
Sema6c C A 3: 95,080,129 (GRCm39) L776M probably damaging Het
Serpinb8 A G 1: 107,534,776 (GRCm39) T32A unknown Het
Sh2b3 A T 5: 121,967,111 (GRCm39) M1K probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spty2d1 T A 7: 46,643,100 (GRCm39) M664L unknown Het
Stk36 T A 1: 74,671,984 (GRCm39) S895T probably null Het
Sycp3 G A 10: 88,308,544 (GRCm39) E205K possibly damaging Het
Taok3 A G 5: 117,338,134 (GRCm39) probably null Het
Tasor2 T C 13: 3,635,122 (GRCm39) N562D possibly damaging Het
Tbc1d16 A T 11: 119,048,654 (GRCm39) I333N probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thumpd2 C T 17: 81,351,557 (GRCm39) W288* probably null Het
Tnks2 T C 19: 36,849,990 (GRCm39) probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpm1 T C 9: 66,938,322 (GRCm39) D254G probably damaging Het
Usp53 A T 3: 122,751,223 (GRCm39) L278* probably null Het
Zfp37 C T 4: 62,110,014 (GRCm39) G350D probably damaging Het
Zfp777 C T 6: 48,002,594 (GRCm39) E543K probably damaging Het
Zfp81 A T 17: 33,553,274 (GRCm39) C513* probably null Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 97,751,833 (GRCm39) missense probably damaging 1.00
IGL00785:Myo7a APN 7 97,703,555 (GRCm39) missense probably damaging 0.99
IGL00840:Myo7a APN 7 97,700,866 (GRCm39) missense probably benign 0.25
IGL01362:Myo7a APN 7 97,746,909 (GRCm39) missense probably damaging 1.00
IGL01484:Myo7a APN 7 97,734,629 (GRCm39) missense probably damaging 1.00
IGL01673:Myo7a APN 7 97,703,915 (GRCm39) missense probably benign 0.00
IGL01933:Myo7a APN 7 97,732,349 (GRCm39) missense probably damaging 1.00
IGL01943:Myo7a APN 7 97,714,854 (GRCm39) missense possibly damaging 0.96
IGL02188:Myo7a APN 7 97,740,234 (GRCm39) missense probably damaging 0.96
IGL02304:Myo7a APN 7 97,726,943 (GRCm39) missense possibly damaging 0.89
IGL02305:Myo7a APN 7 97,700,836 (GRCm39) makesense probably null
IGL02331:Myo7a APN 7 97,702,389 (GRCm39) missense possibly damaging 0.95
IGL02386:Myo7a APN 7 97,724,319 (GRCm39) missense probably damaging 0.99
IGL02389:Myo7a APN 7 97,756,198 (GRCm39) critical splice donor site probably null
IGL02832:Myo7a APN 7 97,740,227 (GRCm39) critical splice donor site probably null
IGL02839:Myo7a APN 7 97,740,329 (GRCm39) missense probably damaging 1.00
IGL03193:Myo7a APN 7 97,740,264 (GRCm39) missense probably damaging 1.00
IGL03237:Myo7a APN 7 97,751,800 (GRCm39) missense probably damaging 1.00
IGL03384:Myo7a APN 7 97,742,800 (GRCm39) missense probably damaging 1.00
coward UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
H8786:Myo7a UTSW 7 97,744,985 (GRCm39) missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 97,728,534 (GRCm39) missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 97,705,974 (GRCm39) missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 97,712,806 (GRCm39) missense probably benign 0.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0054:Myo7a UTSW 7 97,714,905 (GRCm39) missense probably damaging 1.00
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0071:Myo7a UTSW 7 97,706,037 (GRCm39) missense probably damaging 0.98
R0267:Myo7a UTSW 7 97,703,831 (GRCm39) missense probably benign 0.08
R0408:Myo7a UTSW 7 97,705,988 (GRCm39) missense probably damaging 1.00
R0411:Myo7a UTSW 7 97,721,144 (GRCm39) missense probably benign 0.00
R0540:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0607:Myo7a UTSW 7 97,721,153 (GRCm39) missense probably damaging 1.00
R0629:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R0632:Myo7a UTSW 7 97,761,357 (GRCm39) intron probably benign
R0659:Myo7a UTSW 7 97,703,545 (GRCm39) splice site probably benign
R0735:Myo7a UTSW 7 97,730,387 (GRCm39) splice site probably benign
R0924:Myo7a UTSW 7 97,747,463 (GRCm39) missense probably damaging 0.99
R0930:Myo7a UTSW 7 97,747,463 (GRCm39) missense probably damaging 0.99
R1018:Myo7a UTSW 7 97,756,212 (GRCm39) missense probably damaging 1.00
R1196:Myo7a UTSW 7 97,746,880 (GRCm39) missense possibly damaging 0.87
R1331:Myo7a UTSW 7 97,756,215 (GRCm39) missense probably benign 0.00
R1487:Myo7a UTSW 7 97,703,017 (GRCm39) critical splice donor site probably null
R1676:Myo7a UTSW 7 97,748,679 (GRCm39) critical splice donor site probably null
R1695:Myo7a UTSW 7 97,741,703 (GRCm39) missense possibly damaging 0.94
R1770:Myo7a UTSW 7 97,761,813 (GRCm39) intron probably benign
R1781:Myo7a UTSW 7 97,722,331 (GRCm39) missense probably damaging 1.00
R1789:Myo7a UTSW 7 97,756,302 (GRCm39) missense probably damaging 0.99
R1827:Myo7a UTSW 7 97,725,938 (GRCm39) missense probably damaging 0.99
R1864:Myo7a UTSW 7 97,701,463 (GRCm39) missense probably damaging 1.00
R1955:Myo7a UTSW 7 97,704,128 (GRCm39) missense probably damaging 1.00
R2011:Myo7a UTSW 7 97,703,915 (GRCm39) missense possibly damaging 0.69
R2229:Myo7a UTSW 7 97,704,117 (GRCm39) missense probably benign 0.12
R2259:Myo7a UTSW 7 97,718,706 (GRCm39) missense probably damaging 1.00
R2443:Myo7a UTSW 7 97,744,976 (GRCm39) missense probably benign 0.07
R2898:Myo7a UTSW 7 97,703,631 (GRCm39) nonsense probably null
R3158:Myo7a UTSW 7 97,701,499 (GRCm39) missense probably damaging 1.00
R3408:Myo7a UTSW 7 97,730,294 (GRCm39) missense probably benign 0.00
R4222:Myo7a UTSW 7 97,722,436 (GRCm39) missense possibly damaging 0.93
R4255:Myo7a UTSW 7 97,721,171 (GRCm39) missense probably damaging 0.96
R4374:Myo7a UTSW 7 97,751,881 (GRCm39) missense probably damaging 1.00
R4429:Myo7a UTSW 7 97,702,395 (GRCm39) missense probably damaging 0.99
R4445:Myo7a UTSW 7 97,715,611 (GRCm39) missense probably damaging 1.00
R4579:Myo7a UTSW 7 97,722,400 (GRCm39) missense probably damaging 1.00
R4659:Myo7a UTSW 7 97,734,673 (GRCm39) missense probably damaging 1.00
R5073:Myo7a UTSW 7 97,722,425 (GRCm39) nonsense probably null
R5138:Myo7a UTSW 7 97,732,806 (GRCm39) missense probably damaging 1.00
R5566:Myo7a UTSW 7 97,714,023 (GRCm39) missense possibly damaging 0.93
R5580:Myo7a UTSW 7 97,722,367 (GRCm39) missense probably damaging 1.00
R6079:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6138:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
R6451:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6452:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6453:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6454:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6455:Myo7a UTSW 7 97,722,374 (GRCm39) missense probably benign 0.01
R6465:Myo7a UTSW 7 97,711,887 (GRCm39) missense possibly damaging 0.95
R6653:Myo7a UTSW 7 97,703,710 (GRCm39) missense probably damaging 0.96
R6709:Myo7a UTSW 7 97,703,906 (GRCm39) missense probably damaging 1.00
R6917:Myo7a UTSW 7 97,744,970 (GRCm39) missense possibly damaging 0.58
R7313:Myo7a UTSW 7 97,713,402 (GRCm39) missense probably damaging 0.99
R7334:Myo7a UTSW 7 97,728,573 (GRCm39) missense probably benign
R7356:Myo7a UTSW 7 97,751,890 (GRCm39) missense probably benign 0.01
R7393:Myo7a UTSW 7 97,712,906 (GRCm39) missense possibly damaging 0.91
R7422:Myo7a UTSW 7 97,700,833 (GRCm39) splice site probably null
R7472:Myo7a UTSW 7 97,714,000 (GRCm39) missense probably damaging 1.00
R7483:Myo7a UTSW 7 97,712,881 (GRCm39) missense probably benign 0.07
R7526:Myo7a UTSW 7 97,734,655 (GRCm39) missense possibly damaging 0.49
R7948:Myo7a UTSW 7 97,724,236 (GRCm39) missense probably damaging 1.00
R8069:Myo7a UTSW 7 97,732,833 (GRCm39) nonsense probably null
R8115:Myo7a UTSW 7 97,715,653 (GRCm39) missense probably damaging 0.98
R8150:Myo7a UTSW 7 97,712,846 (GRCm39) missense probably benign 0.19
R8265:Myo7a UTSW 7 97,734,604 (GRCm39) missense probably benign 0.00
R8289:Myo7a UTSW 7 97,726,376 (GRCm39) missense probably benign
R8298:Myo7a UTSW 7 97,747,541 (GRCm39) missense probably damaging 1.00
R8518:Myo7a UTSW 7 97,740,270 (GRCm39) missense possibly damaging 0.58
R8539:Myo7a UTSW 7 97,721,668 (GRCm39) missense probably damaging 0.99
R8557:Myo7a UTSW 7 97,703,081 (GRCm39) missense probably benign 0.08
R8685:Myo7a UTSW 7 97,746,334 (GRCm39) missense probably benign 0.03
R8902:Myo7a UTSW 7 97,741,820 (GRCm39) missense probably damaging 1.00
R9034:Myo7a UTSW 7 97,728,465 (GRCm39) missense probably benign 0.40
R9090:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9172:Myo7a UTSW 7 97,732,369 (GRCm39) missense probably benign
R9271:Myo7a UTSW 7 97,740,281 (GRCm39) missense probably benign 0.04
R9334:Myo7a UTSW 7 97,716,369 (GRCm39) missense probably damaging 1.00
R9356:Myo7a UTSW 7 97,725,873 (GRCm39) missense probably benign 0.11
R9444:Myo7a UTSW 7 97,742,698 (GRCm39) missense possibly damaging 0.84
R9459:Myo7a UTSW 7 97,722,380 (GRCm39) missense possibly damaging 0.65
R9513:Myo7a UTSW 7 97,746,818 (GRCm39) critical splice donor site probably null
R9517:Myo7a UTSW 7 97,721,166 (GRCm39) missense probably damaging 1.00
R9629:Myo7a UTSW 7 97,712,937 (GRCm39) missense probably benign 0.03
R9662:Myo7a UTSW 7 97,747,499 (GRCm39) missense possibly damaging 0.55
R9709:Myo7a UTSW 7 97,743,536 (GRCm39) missense possibly damaging 0.79
RF005:Myo7a UTSW 7 97,742,824 (GRCm39) missense probably benign 0.42
U15987:Myo7a UTSW 7 97,714,997 (GRCm39) nonsense probably null
X0028:Myo7a UTSW 7 97,714,932 (GRCm39) missense probably damaging 1.00
X0058:Myo7a UTSW 7 97,711,855 (GRCm39) missense probably benign 0.02
Z1176:Myo7a UTSW 7 97,744,934 (GRCm39) missense probably damaging 0.98
Z1177:Myo7a UTSW 7 97,734,730 (GRCm39) critical splice acceptor site probably null
Z1177:Myo7a UTSW 7 97,701,433 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACATATGCCCAAGTGAGG -3'
(R):5'- TCCCAGTGATATTCAGAGCCTGG -3'

Sequencing Primer
(F):5'- GCACATTGTTTAAGGCACAGAC -3'
(R):5'- CCTGGAGCAGCTGGGTG -3'
Posted On 2015-01-23