Incidental Mutation 'R2898:Olfr578'
ID261360
Institutional Source Beutler Lab
Gene Symbol Olfr578
Ensembl Gene ENSMUSG00000045792
Gene Nameolfactory receptor 578
SynonymsMOR7-1, GA_x6K02T2PBJ9-5696486-5695545
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2898 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102981608-102989324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102984877 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 96 (I96F)
Ref Sequence ENSEMBL: ENSMUSP00000149209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056235] [ENSMUST00000215606]
Predicted Effect probably benign
Transcript: ENSMUST00000056235
AA Change: I96F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058167
Gene: ENSMUSG00000045792
AA Change: I96F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.6e-7 PFAM
Pfam:7tm_1 43 294 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215606
AA Change: I96F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Olfr578
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Olfr578 APN 7 102984702 missense probably damaging 0.97
IGL02658:Olfr578 APN 7 102984330 missense probably benign 0.00
R0833:Olfr578 UTSW 7 102984836 missense possibly damaging 0.50
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R2029:Olfr578 UTSW 7 102984271 missense probably damaging 0.99
R2249:Olfr578 UTSW 7 102984440 missense possibly damaging 0.74
R2413:Olfr578 UTSW 7 102984802 missense probably damaging 1.00
R4441:Olfr578 UTSW 7 102984309 missense possibly damaging 0.65
R5696:Olfr578 UTSW 7 102984541 missense probably benign 0.02
R6810:Olfr578 UTSW 7 102984835 missense probably damaging 1.00
R7263:Olfr578 UTSW 7 102984317 nonsense probably null
R7366:Olfr578 UTSW 7 102984516 missense probably damaging 1.00
R7952:Olfr578 UTSW 7 102984514 missense probably benign 0.00
X0022:Olfr578 UTSW 7 102985026 missense probably benign 0.02
X0028:Olfr578 UTSW 7 102984343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGAGGAGTGCACTTCTGAG -3'
(R):5'- CCATGGCTGGATCTCCATTC -3'

Sequencing Primer
(F):5'- GCACTTCTGAGTACTGAGCTCAG -3'
(R):5'- ATGGCTGGATCTCCATTCCCTTC -3'
Posted On2015-01-23