Incidental Mutation 'R2898:Fbxw21'
ID 261370
Institutional Source Beutler Lab
Gene Symbol Fbxw21
Ensembl Gene ENSMUSG00000047237
Gene Name F-box and WD-40 domain protein 21
Synonyms E330009P21Rik
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 109139447-109162041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109156336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000143095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054925] [ENSMUST00000198076] [ENSMUST00000199540]
AlphaFold Q8BI38
Predicted Effect possibly damaging
Transcript: ENSMUST00000054925
AA Change: T125A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056358
Gene: ENSMUSG00000047237
AA Change: T125A

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 1e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198076
AA Change: T125A

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143095
Gene: ENSMUSG00000047237
AA Change: T125A

DomainStartEndE-ValueType
FBOX 5 45 1.46e-6 SMART
SCOP:d1tbga_ 119 249 9e-8 SMART
Blast:WD40 137 176 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199540
SMART Domains Protein: ENSMUSP00000143200
Gene: ENSMUSG00000047237

DomainStartEndE-ValueType
FBOX 5 45 9e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Fbxw21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Fbxw21 APN 9 109161964 missense probably damaging 1.00
IGL00901:Fbxw21 APN 9 109156399 missense probably benign 0.00
IGL01377:Fbxw21 APN 9 109146645 nonsense probably null
IGL01941:Fbxw21 APN 9 109148156 missense probably benign 0.07
IGL02491:Fbxw21 APN 9 109143819 missense probably benign
IGL03163:Fbxw21 APN 9 109145484 missense probably benign 0.01
IGL03377:Fbxw21 APN 9 109139529 missense probably benign 0.01
R0148:Fbxw21 UTSW 9 109148017 critical splice donor site probably null
R0328:Fbxw21 UTSW 9 109146585 missense possibly damaging 0.52
R0909:Fbxw21 UTSW 9 109156408 missense possibly damaging 0.84
R1506:Fbxw21 UTSW 9 109148189 missense probably damaging 1.00
R1575:Fbxw21 UTSW 9 109161916 missense probably benign 0.00
R1615:Fbxw21 UTSW 9 109143726 missense probably damaging 1.00
R1719:Fbxw21 UTSW 9 109148174 missense possibly damaging 0.85
R2415:Fbxw21 UTSW 9 109156401 missense possibly damaging 0.71
R2424:Fbxw21 UTSW 9 109157519 nonsense probably null
R2508:Fbxw21 UTSW 9 109145485 missense probably benign 0.31
R2964:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2965:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R2966:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R4809:Fbxw21 UTSW 9 109143390 missense probably damaging 1.00
R4911:Fbxw21 UTSW 9 109145663 missense probably damaging 1.00
R5669:Fbxw21 UTSW 9 109145510 missense probably benign 0.12
R5928:Fbxw21 UTSW 9 109143825 missense possibly damaging 0.55
R6043:Fbxw21 UTSW 9 109145539 missense possibly damaging 0.69
R6277:Fbxw21 UTSW 9 109145555 missense possibly damaging 0.95
R6805:Fbxw21 UTSW 9 109157565 missense probably damaging 1.00
R6944:Fbxw21 UTSW 9 109157535 missense probably damaging 1.00
R7079:Fbxw21 UTSW 9 109145510 missense probably benign 0.10
R7081:Fbxw21 UTSW 9 109161922 missense probably damaging 1.00
R7744:Fbxw21 UTSW 9 109157652 missense possibly damaging 0.81
R7774:Fbxw21 UTSW 9 109143840 missense probably benign 0.00
R7980:Fbxw21 UTSW 9 109156571 splice site probably null
R8043:Fbxw21 UTSW 9 109146626 missense probably benign 0.01
R8260:Fbxw21 UTSW 9 109146546 critical splice donor site probably null
R9142:Fbxw21 UTSW 9 109156345 missense probably damaging 1.00
R9172:Fbxw21 UTSW 9 109146696 missense probably benign 0.00
R9250:Fbxw21 UTSW 9 109143778 missense probably benign 0.31
R9251:Fbxw21 UTSW 9 109145619 missense probably damaging 1.00
R9294:Fbxw21 UTSW 9 109143762 missense probably damaging 0.99
R9303:Fbxw21 UTSW 9 109157659 missense probably benign
R9479:Fbxw21 UTSW 9 109139544 missense probably benign 0.00
R9509:Fbxw21 UTSW 9 109148149 missense possibly damaging 0.90
R9765:Fbxw21 UTSW 9 109146557 missense possibly damaging 0.71
R9773:Fbxw21 UTSW 9 109148060 missense possibly damaging 0.89
R9774:Fbxw21 UTSW 9 109161989 start codon destroyed probably null 0.98
Z1088:Fbxw21 UTSW 9 109145537 missense probably benign
Z1176:Fbxw21 UTSW 9 109145537 missense probably benign
Z1177:Fbxw21 UTSW 9 109145537 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACAGCATCTGGCCTCTGC -3'
(R):5'- AGCTTTTATCCATGGCAGAGGG -3'

Sequencing Primer
(F):5'- GTGGTGCAAACCTTTGACC -3'
(R):5'- TTTTATCCATGGCAGAGGGAAGGG -3'
Posted On 2015-01-23