Incidental Mutation 'R2898:Lrriq1'
ID 261375
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 040486-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103063111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 65 (N65S)
Ref Sequence ENSEMBL: ENSMUSP00000119783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000020043
AA Change: N65S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: N65S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123364
AA Change: N65S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: N65S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166240
AA Change: N65S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N65S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 77,413,868 (GRCm39) Q198* probably null Het
Acap3 C T 4: 155,987,916 (GRCm39) R547C possibly damaging Het
Acap3 G C 4: 155,989,388 (GRCm39) probably null Het
Adcy6 A G 15: 98,491,369 (GRCm39) S1075P probably damaging Het
Ankk1 T A 9: 49,333,122 (GRCm39) T121S probably benign Het
Bnc2 T C 4: 84,211,152 (GRCm39) I406V probably damaging Het
Bnipl T A 3: 95,150,360 (GRCm39) H219L probably benign Het
Brwd1 C A 16: 95,867,300 (GRCm39) M178I probably damaging Het
Cep192 T A 18: 67,988,341 (GRCm39) probably null Het
Chd5 T C 4: 152,456,572 (GRCm39) F970L probably damaging Het
Cit A G 5: 116,012,037 (GRCm39) probably null Het
Coq9 T C 8: 95,579,752 (GRCm39) Y236H probably damaging Het
Cxcr2 T C 1: 74,198,130 (GRCm39) V208A probably benign Het
Dnah10 G A 5: 124,894,734 (GRCm39) R3433H probably damaging Het
Dnmt3b G T 2: 153,509,550 (GRCm39) V268L possibly damaging Het
Fbxw21 T C 9: 108,985,404 (GRCm39) T125A possibly damaging Het
Fzd9 T G 5: 135,278,700 (GRCm39) D395A probably damaging Het
Gfm2 T C 13: 97,309,469 (GRCm39) V642A possibly damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Hid1 A G 11: 115,241,356 (GRCm39) S645P probably benign Het
Hmgxb3 C T 18: 61,288,368 (GRCm39) V500M probably benign Het
Hnf1a C T 5: 115,098,106 (GRCm39) W165* probably null Het
Hsd3b1 A T 3: 98,760,623 (GRCm39) C123S probably benign Het
Inpp4a A T 1: 37,405,675 (GRCm39) H148L probably benign Het
Itpr2 C T 6: 146,074,839 (GRCm39) R2338Q probably benign Het
Itpr2 A T 6: 146,224,667 (GRCm39) I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Lmo7 A G 14: 102,114,350 (GRCm39) T31A possibly damaging Het
Lrrc15 C T 16: 30,092,604 (GRCm39) R245H probably benign Het
Mpp4 T C 1: 59,183,853 (GRCm39) I296V probably benign Het
Myo6 T A 9: 80,176,893 (GRCm39) probably null Het
Myo7a G T 7: 97,703,631 (GRCm39) Y2003* probably null Het
Myo7a T C 7: 97,746,413 (GRCm39) N246D probably damaging Het
Ndrg4 A G 8: 96,405,014 (GRCm39) probably null Het
Neu2 A G 1: 87,522,782 (GRCm39) S72G probably benign Het
Or51g1 T A 7: 102,634,084 (GRCm39) I96F probably benign Het
Or8b1c T C 9: 38,384,271 (GRCm39) V76A probably damaging Het
Pcdhb1 A G 18: 37,399,516 (GRCm39) Y489C probably damaging Het
Ppp1r10 A G 17: 36,239,784 (GRCm39) K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 (GRCm39) T371I probably benign Het
Prpf8 A T 11: 75,386,860 (GRCm39) T1102S probably benign Het
Ric8b T G 10: 84,783,761 (GRCm39) D206E probably benign Het
Sacm1l T C 9: 123,389,666 (GRCm39) probably null Het
Sema6c C A 3: 95,080,129 (GRCm39) L776M probably damaging Het
Serpinb8 A G 1: 107,534,776 (GRCm39) T32A unknown Het
Sh2b3 A T 5: 121,967,111 (GRCm39) M1K probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spty2d1 T A 7: 46,643,100 (GRCm39) M664L unknown Het
Stk36 T A 1: 74,671,984 (GRCm39) S895T probably null Het
Sycp3 G A 10: 88,308,544 (GRCm39) E205K possibly damaging Het
Taok3 A G 5: 117,338,134 (GRCm39) probably null Het
Tasor2 T C 13: 3,635,122 (GRCm39) N562D possibly damaging Het
Tbc1d16 A T 11: 119,048,654 (GRCm39) I333N probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thumpd2 C T 17: 81,351,557 (GRCm39) W288* probably null Het
Tnks2 T C 19: 36,849,990 (GRCm39) probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tpm1 T C 9: 66,938,322 (GRCm39) D254G probably damaging Het
Usp53 A T 3: 122,751,223 (GRCm39) L278* probably null Het
Zfp37 C T 4: 62,110,014 (GRCm39) G350D probably damaging Het
Zfp777 C T 6: 48,002,594 (GRCm39) E543K probably damaging Het
Zfp81 A T 17: 33,553,274 (GRCm39) C513* probably null Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAGTACTATTCTGGAAAAGGC -3'
(R):5'- GACCTTTTATATGGGCACTTTTACC -3'

Sequencing Primer
(F):5'- TCTGGAAAAGGCAGAGTTAACCTTC -3'
(R):5'- GGGCACTTTTACCTATTTACACAG -3'
Posted On 2015-01-23