Incidental Mutation 'R2898:Ppp1r10'
ID 261388
Institutional Source Beutler Lab
Gene Symbol Ppp1r10
Ensembl Gene ENSMUSG00000039220
Gene Name protein phosphatase 1, regulatory subunit 10
Synonyms PNUTS, D17Ertd808e, 2610025H06Rik
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2898 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35916434-35932283 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35928892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 501 (K501R)
Ref Sequence ENSEMBL: ENSMUSP00000084461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087210] [ENSMUST00000087211] [ENSMUST00000151664]
AlphaFold Q80W00
Predicted Effect probably damaging
Transcript: ENSMUST00000087210
AA Change: K501R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084460
Gene: ENSMUSG00000039220
AA Change: K501R

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087211
AA Change: K501R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084461
Gene: ENSMUSG00000039220
AA Change: K501R

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151375
Predicted Effect probably benign
Transcript: ENSMUST00000151664
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Ppp1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp1r10 APN 17 35924859 missense probably damaging 0.99
IGL01113:Ppp1r10 APN 17 35929559 missense probably damaging 0.98
IGL01144:Ppp1r10 APN 17 35926564 missense probably benign 0.28
IGL01650:Ppp1r10 APN 17 35931161 missense unknown
IGL02445:Ppp1r10 APN 17 35926202 missense probably damaging 1.00
IGL02715:Ppp1r10 APN 17 35930712 missense unknown
IGL02797:Ppp1r10 APN 17 35928012 critical splice donor site probably null
IGL03181:Ppp1r10 APN 17 35930624 nonsense probably null
R1183:Ppp1r10 UTSW 17 35929443 missense possibly damaging 0.56
R1710:Ppp1r10 UTSW 17 35926536 missense probably damaging 0.96
R2166:Ppp1r10 UTSW 17 35930589 missense unknown
R2865:Ppp1r10 UTSW 17 35928492 missense possibly damaging 0.86
R3692:Ppp1r10 UTSW 17 35930868 missense unknown
R4612:Ppp1r10 UTSW 17 35927931 missense probably damaging 1.00
R4716:Ppp1r10 UTSW 17 35929460 missense probably benign 0.16
R4796:Ppp1r10 UTSW 17 35924087 missense probably damaging 1.00
R4997:Ppp1r10 UTSW 17 35924084 missense probably damaging 1.00
R5152:Ppp1r10 UTSW 17 35929252 missense probably damaging 1.00
R5186:Ppp1r10 UTSW 17 35928511 missense probably damaging 1.00
R5364:Ppp1r10 UTSW 17 35930432 missense unknown
R5705:Ppp1r10 UTSW 17 35929489 missense probably damaging 1.00
R5847:Ppp1r10 UTSW 17 35926847 missense possibly damaging 0.85
R6912:Ppp1r10 UTSW 17 35929561 missense possibly damaging 0.70
R6974:Ppp1r10 UTSW 17 35929551 missense probably benign 0.03
R7169:Ppp1r10 UTSW 17 35929473 missense probably damaging 1.00
R7302:Ppp1r10 UTSW 17 35930881 missense unknown
R7403:Ppp1r10 UTSW 17 35929434 missense probably benign 0.05
R7427:Ppp1r10 UTSW 17 35930133 missense possibly damaging 0.53
R8006:Ppp1r10 UTSW 17 35928266 missense probably benign 0.00
R8850:Ppp1r10 UTSW 17 35928798 missense probably damaging 0.97
R8944:Ppp1r10 UTSW 17 35930126 missense probably benign 0.02
R9497:Ppp1r10 UTSW 17 35924894 missense probably damaging 1.00
R9741:Ppp1r10 UTSW 17 35926439 missense possibly damaging 0.55
Z1088:Ppp1r10 UTSW 17 35930767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CGACATGCTTTCGAGACAGC -3'
(R):5'- TTAGTACCCTCAAGATGGTGTTTTC -3'

Sequencing Primer
(F):5'- AGACAGCTCGGCGACTAAGC -3'
(R):5'- GCTGTCCTGAAACTTACTTTGTAG -3'
Posted On 2015-01-23