Incidental Mutation 'R2898:Thumpd2'
ID261390
Institutional Source Beutler Lab
Gene Symbol Thumpd2
Ensembl Gene ENSMUSG00000024246
Gene NameTHUMP domain containing 2
Synonyms
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2898 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location81026327-81065085 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81044128 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 288 (W288*)
Ref Sequence ENSEMBL: ENSMUSP00000025093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025093]
Predicted Effect probably null
Transcript: ENSMUST00000025093
AA Change: W288*
SMART Domains Protein: ENSMUSP00000025093
Gene: ENSMUSG00000024246
AA Change: W288*

DomainStartEndE-ValueType
THUMP 175 266 4.08e-2 SMART
Pfam:UPF0020 272 425 3e-27 PFAM
Pfam:CMAS 284 429 3e-7 PFAM
Pfam:Ubie_methyltran 285 417 3e-10 PFAM
Pfam:MTS 289 417 2.1e-7 PFAM
Pfam:Methyltransf_31 296 441 7.8e-14 PFAM
Pfam:Methyltransf_11 303 406 1.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Thumpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Thumpd2 APN 17 81054386 missense probably benign 0.00
IGL02409:Thumpd2 APN 17 81032688 missense probably damaging 1.00
IGL02546:Thumpd2 APN 17 81054455 missense probably benign 0.16
IGL03357:Thumpd2 APN 17 81044090 splice site probably benign
R1295:Thumpd2 UTSW 17 81055888 missense probably damaging 1.00
R2030:Thumpd2 UTSW 17 81064958 missense probably damaging 1.00
R4805:Thumpd2 UTSW 17 81026701 missense probably damaging 0.98
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R5328:Thumpd2 UTSW 17 81044162 missense possibly damaging 0.64
R5359:Thumpd2 UTSW 17 81026777 missense probably benign 0.16
R6207:Thumpd2 UTSW 17 81055837 missense probably damaging 1.00
R6218:Thumpd2 UTSW 17 81052913 missense probably damaging 1.00
R6484:Thumpd2 UTSW 17 81054188 missense probably benign 0.01
R6853:Thumpd2 UTSW 17 81065030 missense possibly damaging 0.75
R6855:Thumpd2 UTSW 17 81044170 missense probably damaging 1.00
R6917:Thumpd2 UTSW 17 81044114 missense probably benign 0.00
R7018:Thumpd2 UTSW 17 81055897 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAAAGGCTATTAAGTCCATTGGC -3'
(R):5'- GTGCTAAGTAAGAGGTTTCCTTCATG -3'

Sequencing Primer
(F):5'- ATTAAGTCCATTGGCAGCTGC -3'
(R):5'- CTTTCTTGCAGAATGCCCT -3'
Posted On2015-01-23