Incidental Mutation 'R2898:Pcdhb1'
ID261391
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2898 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37266463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 489 (Y489C)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: Y489C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: Y489C

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.6937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
R7392:Pcdhb1 UTSW 18 37265118 missense possibly damaging 0.95
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGACCACCCAATCTGTC -3'
(R):5'- ACGATTGTCATTGTCGTCCAGG -3'

Sequencing Primer
(F):5'- GGACCACCCAATCTGTCCACAG -3'
(R):5'- GTCATTGTCGTCCAGGACCAC -3'
Posted On2015-01-23