Incidental Mutation 'R2898:Cep192'
ID261393
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Namecentrosomal protein 192
Synonyms4631422C13Rik, D430014P18Rik
MMRRC Submission 040486-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2898 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67800107-67885170 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 67855270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
Predicted Effect probably null
Transcript: ENSMUST00000025425
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224921
Predicted Effect probably benign
Transcript: ENSMUST00000225303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225677
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 C T 4: 155,903,459 R547C possibly damaging Het
Acap3 G C 4: 155,904,931 probably null Het
Adcy6 A G 15: 98,593,488 S1075P probably damaging Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Bnipl T A 3: 95,243,049 H219L probably benign Het
Brwd1 C A 16: 96,066,100 M178I probably damaging Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Cit A G 5: 115,873,978 probably null Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Dnah10 G A 5: 124,817,670 R3433H probably damaging Het
Dnmt3b G T 2: 153,667,630 V268L possibly damaging Het
Fam208b T C 13: 3,585,122 N562D possibly damaging Het
Fbxw21 T C 9: 109,156,336 T125A possibly damaging Het
Fzd9 T G 5: 135,249,846 D395A probably damaging Het
Gfm2 T C 13: 97,172,961 V642A possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmgxb3 C T 18: 61,155,296 V500M probably benign Het
Hnf1a C T 5: 114,960,047 W165* probably null Het
Hsd3b1 A T 3: 98,853,307 C123S probably benign Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lmo7 A G 14: 101,876,914 T31A possibly damaging Het
Lrrc15 C T 16: 30,273,786 R245H probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Myo6 T A 9: 80,269,611 probably null Het
Myo7a G T 7: 98,054,424 Y2003* probably null Het
Myo7a T C 7: 98,097,206 N246D probably damaging Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Olfr578 T A 7: 102,984,877 I96F probably benign Het
Olfr905 T C 9: 38,472,975 V76A probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Ppp1r10 A G 17: 35,928,892 K501R probably damaging Het
Ppp1r9a C T 6: 4,906,558 T371I probably benign Het
Prpf8 A T 11: 75,496,034 T1102S probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sacm1l T C 9: 123,560,601 probably null Het
Sema6c C A 3: 95,172,818 L776M probably damaging Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Sh2b3 A T 5: 121,829,048 M1K probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spty2d1 T A 7: 46,993,352 M664L unknown Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Taok3 A G 5: 117,200,069 probably null Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Thumpd2 C T 17: 81,044,128 W288* probably null Het
Tnks2 T C 19: 36,872,590 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpm1 T C 9: 67,031,040 D254G probably damaging Het
Usp53 A T 3: 122,957,574 L278* probably null Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Zfp777 C T 6: 48,025,660 E543K probably damaging Het
Zfp81 A T 17: 33,334,300 C513* probably null Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0281:Cep192 UTSW 18 67828482 splice site probably benign
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4591:Cep192 UTSW 18 67834968 missense probably damaging 0.99
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4725:Cep192 UTSW 18 67816766 missense probably benign
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67834713 missense probably damaging 1.00
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R6861:Cep192 UTSW 18 67841628 missense probably benign 0.43
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTTCCCTTGTTAAGATGAACC -3'
(R):5'- CATTGGCTATACAGTGAAACCC -3'

Sequencing Primer
(F):5'- GTGGAGAGATGATCTAGTCT -3'
(R):5'- TGGCTATACAGTGAAACCCTGCTG -3'
Posted On2015-01-23