Mutagenetix > Incidental Mutation

Incidental Mutation 'R2899:Zc3h6'

261403

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

040487-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R2899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129002232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 232 (V232A)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110320
AA Change: V232A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: V232A

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (30/31)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,682	K211E	probably benign	Het
4930430A15Rik	C	A	2: 111,220,670		probably benign	Het
Amigo3	T	C	9: 108,054,154	S259P	probably benign	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Cd200r4	T	C	16: 44,833,365	I175T	probably damaging	Het
Cep131	T	C	11: 120,072,028	D425G	probably benign	Het
Clmp	T	C	9: 40,782,392	S302P	probably damaging	Het
Dusp6	T	C	10: 99,263,845	S52P	probably damaging	Het
Epha5	T	A	5: 84,233,808	I395F	probably damaging	Het
F5	A	G	1: 164,186,900	E580G	possibly damaging	Het
Fbxo3	T	A	2: 104,051,135	Y271N	probably damaging	Het
Fuca1	G	A	4: 135,923,012	W131*	probably null	Het
Gdf7	C	T	12: 8,298,470	A276T	unknown	Het
Limk1	A	T	5: 134,688,300		probably null	Het
Lrrc37a	G	A	11: 103,497,864	T2245I	unknown	Het
Neb	A	G	2: 52,185,323	I210T	probably benign	Het
Nf1	T	G	11: 79,412,758	N420K	possibly damaging	Het
Olfr1453	T	A	19: 13,027,694	I212F	probably damaging	Het
Pask	G	T	1: 93,334,547	T197K	probably damaging	Het
Pou4f3	T	C	18: 42,395,523	L177P	probably benign	Het
Rassf1	G	A	9: 107,554,194	G107R	probably null	Het
Rdx	T	C	9: 52,068,911		probably benign	Het
Saraf	T	C	8: 34,161,231	L77P	probably damaging	Het
Syngap1	A	G	17: 26,959,985	E483G	probably damaging	Het
Tsku	T	C	7: 98,352,917	N69S	probably damaging	Het
Usp36	G	A	11: 118,276,756		probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zfp143	T	A	7: 110,072,129	S99R	probably damaging	Het
Zkscan3	A	T	13: 21,393,973	L219Q	probably damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTATCCCCATGGACTCTGC -3'
(R):5'- GGAGTACGGAATATGGTTTACTCAG -3'

Sequencing Primer
(F):5'- ACCTTTCCTAATGGTAGACTGTG -3'
(R):5'- CGGAATATGGTTTACTCAGAAACAC -3'

Posted On

2015-01-23