Mutagenetix > Incidental Mutation

Incidental Mutation 'R2899:Usp36'

261418

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

040487-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R2899 (G1)

Quality Score

157

Status

Validated

Chromosome

Chromosomal Location

118150477-118181070 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 118167582 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

probably benign
Transcript: ENSMUST00000092382

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106296

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 137,771,443 (GRCm39)	K211E	probably benign	Het
Amigo3	T	C	9: 107,931,353 (GRCm39)	S259P	probably benign	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Cd200r4	T	C	16: 44,653,728 (GRCm39)	I175T	probably damaging	Het
Cep131	T	C	11: 119,962,854 (GRCm39)	D425G	probably benign	Het
Clmp	T	C	9: 40,693,688 (GRCm39)	S302P	probably damaging	Het
Dusp6	T	C	10: 99,099,707 (GRCm39)	S52P	probably damaging	Het
Epha5	T	A	5: 84,381,667 (GRCm39)	I395F	probably damaging	Het
F5	A	G	1: 164,014,469 (GRCm39)	E580G	possibly damaging	Het
Fbxo3	T	A	2: 103,881,480 (GRCm39)	Y271N	probably damaging	Het
Fuca1	G	A	4: 135,650,323 (GRCm39)	W131*	probably null	Het
Gdf7	C	T	12: 8,348,470 (GRCm39)	A276T	unknown	Het
Limk1	A	T	5: 134,717,154 (GRCm39)		probably null	Het
Lrrc37a	G	A	11: 103,388,690 (GRCm39)	T2245I	unknown	Het
Neb	A	G	2: 52,075,335 (GRCm39)	I210T	probably benign	Het
Nf1	T	G	11: 79,303,584 (GRCm39)	N420K	possibly damaging	Het
Or5b101	T	A	19: 13,005,058 (GRCm39)	I212F	probably damaging	Het
Pask	G	T	1: 93,262,269 (GRCm39)	T197K	probably damaging	Het
Potefam1	C	A	2: 111,051,015 (GRCm39)		probably benign	Het
Pou4f3	T	C	18: 42,528,588 (GRCm39)	L177P	probably benign	Het
Rassf1	G	A	9: 107,431,393 (GRCm39)	G107R	probably null	Het
Rdx	T	C	9: 51,980,211 (GRCm39)		probably benign	Het
Saraf	T	C	8: 34,628,385 (GRCm39)	L77P	probably damaging	Het
Syngap1	A	G	17: 27,178,959 (GRCm39)	E483G	probably damaging	Het
Tsku	T	C	7: 98,002,124 (GRCm39)	N69S	probably damaging	Het
Vmn2r129	G	T	4: 156,686,692 (GRCm39)		noncoding transcript	Het
Zc3h6	T	C	2: 128,844,152 (GRCm39)	V232A	probably benign	Het
Zfp143	T	A	7: 109,671,336 (GRCm39)	S99R	probably damaging	Het
Zkscan3	A	T	13: 21,578,143 (GRCm39)	L219Q	probably damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118,155,646 (GRCm39)	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118,176,786 (GRCm39)	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118,165,828 (GRCm39)	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118,167,011 (GRCm39)	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118,166,983 (GRCm39)	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118,155,609 (GRCm39)	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118,170,067 (GRCm39)	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118,176,636 (GRCm39)	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118,155,635 (GRCm39)	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118,156,020 (GRCm39)	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118,164,397 (GRCm39)	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118,153,854 (GRCm39)	splice site	probably benign
R0646:Usp36	UTSW	11	118,163,847 (GRCm39)	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118,175,771 (GRCm39)	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118,164,392 (GRCm39)	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118,162,957 (GRCm39)	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118,163,784 (GRCm39)	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118,153,334 (GRCm39)	splice site	probably benign
R2068:Usp36	UTSW	11	118,165,844 (GRCm39)	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118,159,491 (GRCm39)	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118,175,849 (GRCm39)	missense	possibly damaging	0.95
R3176:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118,167,585 (GRCm39)	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118,153,878 (GRCm39)	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118,170,650 (GRCm39)	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118,170,650 (GRCm39)	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118,176,621 (GRCm39)	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118,153,896 (GRCm39)	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118,155,731 (GRCm39)	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118,156,020 (GRCm39)	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118,168,100 (GRCm39)	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118,159,411 (GRCm39)	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118,159,660 (GRCm39)	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118,155,980 (GRCm39)	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118,164,355 (GRCm39)	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118,152,872 (GRCm39)	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118,154,522 (GRCm39)	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118,176,791 (GRCm39)	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118,155,716 (GRCm39)	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118,165,840 (GRCm39)	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118,167,657 (GRCm39)	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118,175,825 (GRCm39)	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118,166,983 (GRCm39)	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118,160,031 (GRCm39)	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118,159,461 (GRCm39)	nonsense	probably null
R9774:Usp36	UTSW	11	118,153,875 (GRCm39)	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118,164,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118,167,026 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGAAATTTGCATAGGAGAACTGC -3'
(R):5'- AACCTGGCCTCACCTGTATC -3'

Sequencing Primer
(F):5'- CAGACAGATGCAAATGTTGGCCTG -3'
(R):5'- CCAGTTGGTGGGTCAGTCAC -3'

Posted On

2015-01-23