Incidental Mutation 'R2899:Gdf7'
ID 261420
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
MMRRC Submission 040487-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.797) question?
Stock # R2899 (G1)
Quality Score 198
Status Validated
Chromosome 12
Chromosomal Location 8297918-8301954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8298470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 276 (A276T)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: A284T
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: A284T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217967
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: A276T
Meta Mutation Damage Score 0.2465 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,682 K211E probably benign Het
4930430A15Rik C A 2: 111,220,670 probably benign Het
Amigo3 T C 9: 108,054,154 S259P probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cd200r4 T C 16: 44,833,365 I175T probably damaging Het
Cep131 T C 11: 120,072,028 D425G probably benign Het
Clmp T C 9: 40,782,392 S302P probably damaging Het
Dusp6 T C 10: 99,263,845 S52P probably damaging Het
Epha5 T A 5: 84,233,808 I395F probably damaging Het
F5 A G 1: 164,186,900 E580G possibly damaging Het
Fbxo3 T A 2: 104,051,135 Y271N probably damaging Het
Fuca1 G A 4: 135,923,012 W131* probably null Het
Limk1 A T 5: 134,688,300 probably null Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Neb A G 2: 52,185,323 I210T probably benign Het
Nf1 T G 11: 79,412,758 N420K possibly damaging Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Pask G T 1: 93,334,547 T197K probably damaging Het
Pou4f3 T C 18: 42,395,523 L177P probably benign Het
Rassf1 G A 9: 107,554,194 G107R probably null Het
Rdx T C 9: 52,068,911 probably benign Het
Saraf T C 8: 34,161,231 L77P probably damaging Het
Syngap1 A G 17: 26,959,985 E483G probably damaging Het
Tsku T C 7: 98,352,917 N69S probably damaging Het
Usp36 G A 11: 118,276,756 probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zc3h6 T C 2: 129,002,232 V232A probably benign Het
Zfp143 T A 7: 110,072,129 S99R probably damaging Het
Zkscan3 A T 13: 21,393,973 L219Q probably damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
R8705:Gdf7 UTSW 12 8298167 missense probably damaging 0.96
R8845:Gdf7 UTSW 12 8298905 missense unknown
R9100:Gdf7 UTSW 12 8298652 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTCCTTAAAGTCCACGTG -3'
(R):5'- TCCTGTTCGACGTATCCAGC -3'

Sequencing Primer
(F):5'- ACGTGCAGTGACTTGCGAC -3'
(R):5'- AAGCGTTCGACGTGACG -3'
Posted On 2015-01-23