Incidental Mutation 'R2900:Pdlim1'
ID261454
Institutional Source Beutler Lab
Gene Symbol Pdlim1
Ensembl Gene ENSMUSG00000055044
Gene NamePDZ and LIM domain 1 (elfin)
SynonymsCLP36, mClim1
MMRRC Submission 040488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2900 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40221173-40271842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40223075 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 258 (C258Y)
Ref Sequence ENSEMBL: ENSMUSP00000064545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068439]
Predicted Effect probably damaging
Transcript: ENSMUST00000068439
AA Change: C258Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: C258Y

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Pfam:DUF4749 136 234 4.6e-29 PFAM
LIM 257 308 2.31e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182813
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 C T 10: 41,424,755 H1654Y unknown Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cmtm1 A G 8: 104,309,544 V151A possibly damaging Het
Coro6 A G 11: 77,467,813 I233V probably benign Het
Cyp26b1 C T 6: 84,576,641 R252H possibly damaging Het
Dcdc2a C A 13: 25,120,498 D351E probably benign Het
Flnc T C 6: 29,448,585 F1274S probably damaging Het
Fut7 A G 2: 25,423,911 K33E probably benign Het
Gpsm1 G T 2: 26,345,162 V480L probably benign Het
Hoxc9 A T 15: 102,981,753 H34L probably benign Het
Ighv1-4 A G 12: 114,487,168 S107P probably benign Het
Itsn2 T C 12: 4,630,713 probably benign Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med18 G A 4: 132,459,817 R124C probably damaging Het
Ms4a6d C T 19: 11,590,144 G23D probably damaging Het
Pan2 T A 10: 128,308,342 D135E probably benign Het
Ppp6r2 C A 15: 89,281,995 P734H probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stat5a G A 11: 100,874,131 V227M probably benign Het
Strip2 A T 6: 29,939,035 probably null Het
Syn2 C T 6: 115,237,334 T173I possibly damaging Het
Thbd C A 2: 148,406,214 *578L probably null Het
Tnfrsf11a T C 1: 105,827,061 I286T probably benign Het
Zfp566 T C 7: 30,078,243 D171G possibly damaging Het
Zfp938 T C 10: 82,225,506 R427G possibly damaging Het
Other mutations in Pdlim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Pdlim1 APN 19 40243466 missense probably benign 0.00
IGL02253:Pdlim1 APN 19 40230530 missense probably damaging 0.99
IGL02312:Pdlim1 APN 19 40223061 missense probably benign 0.00
IGL02584:Pdlim1 APN 19 40243400 splice site probably null
R0391:Pdlim1 UTSW 19 40243573 missense probably damaging 0.99
R1554:Pdlim1 UTSW 19 40223072 missense probably benign 0.19
R1751:Pdlim1 UTSW 19 40251904 splice site probably benign
R1972:Pdlim1 UTSW 19 40223137 missense probably damaging 0.99
R4709:Pdlim1 UTSW 19 40222736 missense probably benign 0.26
R4803:Pdlim1 UTSW 19 40243448 missense possibly damaging 0.94
R4818:Pdlim1 UTSW 19 40223136 missense probably damaging 0.98
R5360:Pdlim1 UTSW 19 40230549 missense probably damaging 0.99
R5833:Pdlim1 UTSW 19 40230545 missense probably damaging 1.00
R6547:Pdlim1 UTSW 19 40223120 missense probably damaging 0.97
R7699:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7700:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7756:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7758:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7914:Pdlim1 UTSW 19 40252001 missense probably damaging 0.98
R8201:Pdlim1 UTSW 19 40230514 missense probably benign
R8331:Pdlim1 UTSW 19 40230551 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TTCTTCAGAGGCCCTACAGCAG -3'
(R):5'- CACAGGTGGTTCTGAGAGAG -3'

Sequencing Primer
(F):5'- TGAATGGGAAGACTCGTCATTC -3'
(R):5'- TTCTGAGAGAGCCCAGTAATACTG -3'
Posted On2015-01-23