Incidental Mutation 'R2901:Klhl20'
ID261458
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Namekelch-like 20
SynonymsD930050H05Rik
MMRRC Submission 040489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R2901 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161088375-161131511 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 161109552 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 84 (C84*)
Ref Sequence ENSEMBL: ENSMUSP00000114044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467]
Predicted Effect probably null
Transcript: ENSMUST00000111611
AA Change: C84*
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: C84*

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117467
AA Change: C84*
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: C84*

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148952
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T C 1: 134,390,924 L478P probably damaging Het
Abhd13 T A 8: 9,988,231 M276K probably damaging Het
Angpt4 G T 2: 151,911,339 C3F unknown Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cep192 C T 18: 67,869,441 R2236C possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Dnah7a A T 1: 53,427,872 L3611Q probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm3336 T C 8: 70,720,626 S96P possibly damaging Het
Gm9845 T A 3: 39,358,593 noncoding transcript Het
Klf12 G T 14: 99,900,146 F321L probably damaging Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lpin1 T C 12: 16,553,998 K578E probably benign Het
Mrc1 A G 2: 14,328,543 H1345R possibly damaging Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Olfr1490 C T 19: 13,654,945 P167L probably damaging Het
Olfr954 T A 9: 39,461,938 I169N probably damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Ptp4a1 T C 1: 30,943,304 N142D possibly damaging Het
Simc1 G A 13: 54,541,518 probably null Het
Snai2 T C 16: 14,705,983 S4P possibly damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Stmn2 A G 3: 8,541,921 I34V probably benign Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Ubr3 T C 2: 70,016,192 S1620P possibly damaging Het
Vps51 G A 19: 6,076,438 R95W probably damaging Het
Zufsp C T 10: 33,927,612 R492Q probably damaging Het
Zufsp T C 10: 33,928,063 T472A probably benign Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 161109755 missense probably benign 0.00
IGL00903:Klhl20 APN 1 161090506 missense probably benign 0.00
IGL01574:Klhl20 APN 1 161093726 missense probably damaging 1.00
IGL01721:Klhl20 APN 1 161095587 missense probably damaging 1.00
IGL01933:Klhl20 APN 1 161106787 missense probably damaging 1.00
IGL02187:Klhl20 APN 1 161109710 missense probably benign 0.05
IGL02634:Klhl20 APN 1 161098365 missense probably damaging 0.98
IGL02691:Klhl20 APN 1 161106874 splice site probably benign
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0639:Klhl20 UTSW 1 161093711 missense probably damaging 1.00
R1730:Klhl20 UTSW 1 161102990 missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 161106742 missense probably benign 0.00
R2016:Klhl20 UTSW 1 161103038 missense probably damaging 0.98
R4822:Klhl20 UTSW 1 161093763 nonsense probably null
R4830:Klhl20 UTSW 1 161098376 missense probably benign 0.00
R4894:Klhl20 UTSW 1 161109532 missense possibly damaging 0.76
R4981:Klhl20 UTSW 1 161103005 missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 161101586 missense probably damaging 0.98
R5023:Klhl20 UTSW 1 161109220 critical splice donor site probably null
R5108:Klhl20 UTSW 1 161099250 missense probably damaging 0.99
R5216:Klhl20 UTSW 1 161093679 critical splice donor site probably null
R5659:Klhl20 UTSW 1 161090470 missense probably damaging 1.00
R6159:Klhl20 UTSW 1 161105467 missense probably damaging 1.00
R6836:Klhl20 UTSW 1 161105406 missense probably benign 0.18
R6914:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6915:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 161109257 missense probably benign 0.01
R8085:Klhl20 UTSW 1 161093784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTTCTGCCAGCTGGAGGAG -3'
(R):5'- ATGTAACAAGCCGCTGCAC -3'

Sequencing Primer
(F):5'- CCAGCTGGAGGAGGCAAGC -3'
(R):5'- TGGAGACCCCAACAAGCTG -3'
Posted On2015-01-23