Incidental Mutation 'R2901:Clvs1'
ID261465
Institutional Source Beutler Lab
Gene Symbol Clvs1
Ensembl Gene ENSMUSG00000041216
Gene Nameclavesin 1
Synonyms4933402J24Rik, Rlbp1l1
MMRRC Submission 040489-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2901 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location9269293-9451691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9281972 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 139 (K139E)
Ref Sequence ENSEMBL: ENSMUSP00000103985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000108348]
Predicted Effect probably damaging
Transcript: ENSMUST00000038841
AA Change: K139E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216
AA Change: K139E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108348
AA Change: K139E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216
AA Change: K139E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149848
Meta Mutation Damage Score 0.1941 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T C 1: 134,390,924 L478P probably damaging Het
Abhd13 T A 8: 9,988,231 M276K probably damaging Het
Angpt4 G T 2: 151,911,339 C3F unknown Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cep192 C T 18: 67,869,441 R2236C possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Dnah7a A T 1: 53,427,872 L3611Q probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm3336 T C 8: 70,720,626 S96P possibly damaging Het
Gm9845 T A 3: 39,358,593 noncoding transcript Het
Klf12 G T 14: 99,900,146 F321L probably damaging Het
Klhl20 G T 1: 161,109,552 C84* probably null Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lpin1 T C 12: 16,553,998 K578E probably benign Het
Mrc1 A G 2: 14,328,543 H1345R possibly damaging Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Olfr1490 C T 19: 13,654,945 P167L probably damaging Het
Olfr954 T A 9: 39,461,938 I169N probably damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Ptp4a1 T C 1: 30,943,304 N142D possibly damaging Het
Simc1 G A 13: 54,541,518 probably null Het
Snai2 T C 16: 14,705,983 S4P possibly damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Stmn2 A G 3: 8,541,921 I34V probably benign Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Ubr3 T C 2: 70,016,192 S1620P possibly damaging Het
Vps51 G A 19: 6,076,438 R95W probably damaging Het
Zufsp C T 10: 33,927,612 R492Q probably damaging Het
Zufsp T C 10: 33,928,063 T472A probably benign Het
Other mutations in Clvs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Clvs1 APN 4 9281939 missense probably damaging 1.00
IGL01293:Clvs1 APN 4 9281559 start codon destroyed probably null
IGL01463:Clvs1 APN 4 9429818 missense probably benign 0.27
IGL03031:Clvs1 APN 4 9449385 splice site probably benign
R0472:Clvs1 UTSW 4 9281801 missense probably damaging 1.00
R0496:Clvs1 UTSW 4 9424241 missense probably damaging 1.00
R0848:Clvs1 UTSW 4 9282003 missense possibly damaging 0.83
R1541:Clvs1 UTSW 4 9281814 missense probably benign 0.00
R1992:Clvs1 UTSW 4 9281899 missense probably benign 0.01
R2902:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R4321:Clvs1 UTSW 4 9282029 intron probably benign
R4934:Clvs1 UTSW 4 9424216 missense possibly damaging 0.91
R4946:Clvs1 UTSW 4 9281831 nonsense probably null
R4970:Clvs1 UTSW 4 9350857 intron probably benign
R5187:Clvs1 UTSW 4 9281865 missense possibly damaging 0.53
R5327:Clvs1 UTSW 4 9424261 missense probably damaging 1.00
R5605:Clvs1 UTSW 4 9281751 missense probably damaging 0.98
R5940:Clvs1 UTSW 4 9449443 missense possibly damaging 0.96
R6818:Clvs1 UTSW 4 9282014 critical splice donor site probably null
R6857:Clvs1 UTSW 4 9449433 missense probably benign 0.00
R7692:Clvs1 UTSW 4 9350739 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCCAGGAAGTTTCACCAAGC -3'
(R):5'- AAAGTCCAGTGCAACTCAGAGG -3'

Sequencing Primer
(F):5'- GGAAGTTTCACCAAGCCGATGC -3'
(R):5'- GTGCAACTCAGAGGCTATAGTTCTC -3'
Posted On2015-01-23