Incidental Mutation 'R2901:Abhd13'
ID261468
Institutional Source Beutler Lab
Gene Symbol Abhd13
Ensembl Gene ENSMUSG00000040396
Gene Nameabhydrolase domain containing 13
Synonyms
MMRRC Submission 040489-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2901 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location9977707-9992155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9988231 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 276 (M276K)
Ref Sequence ENSEMBL: ENSMUSP00000116130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048216] [ENSMUST00000139793]
Predicted Effect probably damaging
Transcript: ENSMUST00000048216
AA Change: M276K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036730
Gene: ENSMUSG00000040396
AA Change: M276K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Abhydrolase_5 116 299 5.6e-24 PFAM
Pfam:Abhydrolase_3 117 279 1.7e-6 PFAM
Pfam:Abhydrolase_6 117 310 4.9e-15 PFAM
Pfam:Abhydrolase_1 143 245 1.8e-8 PFAM
Pfam:AXE1 163 229 3.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139793
AA Change: M276K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116130
Gene: ENSMUSG00000040396
AA Change: M276K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Hydrolase_4 111 250 2.5e-11 PFAM
Pfam:Abhydrolase_1 115 237 3.2e-11 PFAM
Pfam:Abhydrolase_5 116 299 6.3e-24 PFAM
Pfam:Abhydrolase_6 117 241 2.9e-8 PFAM
Pfam:AXE1 162 229 9.1e-8 PFAM
Meta Mutation Damage Score 0.7622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T C 1: 134,390,924 L478P probably damaging Het
Angpt4 G T 2: 151,911,339 C3F unknown Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cep192 C T 18: 67,869,441 R2236C possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Dnah7a A T 1: 53,427,872 L3611Q probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm3336 T C 8: 70,720,626 S96P possibly damaging Het
Gm9845 T A 3: 39,358,593 noncoding transcript Het
Klf12 G T 14: 99,900,146 F321L probably damaging Het
Klhl20 G T 1: 161,109,552 C84* probably null Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lpin1 T C 12: 16,553,998 K578E probably benign Het
Mrc1 A G 2: 14,328,543 H1345R possibly damaging Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Olfr1490 C T 19: 13,654,945 P167L probably damaging Het
Olfr954 T A 9: 39,461,938 I169N probably damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Ptp4a1 T C 1: 30,943,304 N142D possibly damaging Het
Simc1 G A 13: 54,541,518 probably null Het
Snai2 T C 16: 14,705,983 S4P possibly damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Stmn2 A G 3: 8,541,921 I34V probably benign Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Ubr3 T C 2: 70,016,192 S1620P possibly damaging Het
Vps51 G A 19: 6,076,438 R95W probably damaging Het
Zufsp C T 10: 33,927,612 R492Q probably damaging Het
Zufsp T C 10: 33,928,063 T472A probably benign Het
Other mutations in Abhd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Abhd13 APN 8 9987900 missense possibly damaging 0.86
PIT4243001:Abhd13 UTSW 8 9987967 missense possibly damaging 0.89
R0242:Abhd13 UTSW 8 9987561 missense probably benign 0.00
R0242:Abhd13 UTSW 8 9987561 missense probably benign 0.00
R0350:Abhd13 UTSW 8 9987600 missense probably damaging 1.00
R1487:Abhd13 UTSW 8 9987402 start gained probably benign
R1906:Abhd13 UTSW 8 9988170 missense probably benign 0.11
R1907:Abhd13 UTSW 8 9988170 missense probably benign 0.11
R3105:Abhd13 UTSW 8 9987931 missense probably benign 0.05
R3413:Abhd13 UTSW 8 9987387 splice site probably benign
R4569:Abhd13 UTSW 8 9988071 missense possibly damaging 0.94
R5586:Abhd13 UTSW 8 9988318 missense probably benign 0.23
R6373:Abhd13 UTSW 8 9988240 missense probably damaging 1.00
R6526:Abhd13 UTSW 8 9987777 missense probably damaging 1.00
R6776:Abhd13 UTSW 8 9988075 missense probably benign 0.03
R7315:Abhd13 UTSW 8 9987970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGCCATCATGGTGGAGAAC -3'
(R):5'- CCAAGGCATCCATCAAGAGG -3'

Sequencing Primer
(F):5'- TGGAGAACACATTCCTAAGCATAC -3'
(R):5'- TCAAGAGGATGGCATCAGATG -3'
Posted On2015-01-23