Incidental Mutation 'R2901:Cep68'
ID261474
Institutional Source Beutler Lab
Gene Symbol Cep68
Ensembl Gene ENSMUSG00000044066
Gene Namecentrosomal protein 68
Synonyms
MMRRC Submission 040489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2901 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location20227037-20249429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20240187 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 275 (L275P)
Ref Sequence ENSEMBL: ENSMUSP00000125113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050611] [ENSMUST00000109596] [ENSMUST00000162811]
Predicted Effect probably damaging
Transcript: ENSMUST00000050611
AA Change: L275P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054943
Gene: ENSMUSG00000044066
AA Change: L275P

DomainStartEndE-ValueType
low complexity region 178 190 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
SPEC 605 706 1.28e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109596
AA Change: L275P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105225
Gene: ENSMUSG00000044066
AA Change: L275P

DomainStartEndE-ValueType
low complexity region 178 190 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
SCOP:d1quua1 594 648 1e-2 SMART
Blast:SPEC 605 646 6e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161218
Predicted Effect probably damaging
Transcript: ENSMUST00000162811
AA Change: L275P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125113
Gene: ENSMUSG00000044066
AA Change: L275P

DomainStartEndE-ValueType
low complexity region 178 190 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
Meta Mutation Damage Score 0.1709 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T C 1: 134,390,924 L478P probably damaging Het
Abhd13 T A 8: 9,988,231 M276K probably damaging Het
Angpt4 G T 2: 151,911,339 C3F unknown Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cep192 C T 18: 67,869,441 R2236C possibly damaging Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Dnah7a A T 1: 53,427,872 L3611Q probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm3336 T C 8: 70,720,626 S96P possibly damaging Het
Gm9845 T A 3: 39,358,593 noncoding transcript Het
Klf12 G T 14: 99,900,146 F321L probably damaging Het
Klhl20 G T 1: 161,109,552 C84* probably null Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lpin1 T C 12: 16,553,998 K578E probably benign Het
Mrc1 A G 2: 14,328,543 H1345R possibly damaging Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Olfr1490 C T 19: 13,654,945 P167L probably damaging Het
Olfr954 T A 9: 39,461,938 I169N probably damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Ptp4a1 T C 1: 30,943,304 N142D possibly damaging Het
Simc1 G A 13: 54,541,518 probably null Het
Snai2 T C 16: 14,705,983 S4P possibly damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Stmn2 A G 3: 8,541,921 I34V probably benign Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Ubr3 T C 2: 70,016,192 S1620P possibly damaging Het
Vps51 G A 19: 6,076,438 R95W probably damaging Het
Zufsp C T 10: 33,927,612 R492Q probably damaging Het
Zufsp T C 10: 33,928,063 T472A probably benign Het
Other mutations in Cep68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Cep68 APN 11 20239510 missense probably benign 0.14
IGL02404:Cep68 APN 11 20240004 missense possibly damaging 0.89
IGL02441:Cep68 APN 11 20239186 missense probably benign 0.01
IGL02554:Cep68 APN 11 20240096 missense possibly damaging 0.61
IGL02732:Cep68 APN 11 20236109 unclassified probably benign
PIT4366001:Cep68 UTSW 11 20240007 missense probably benign 0.21
PIT4418001:Cep68 UTSW 11 20239731 missense probably benign
R0399:Cep68 UTSW 11 20230571 missense probably benign 0.10
R0792:Cep68 UTSW 11 20240652 missense possibly damaging 0.76
R0882:Cep68 UTSW 11 20239393 missense probably benign
R1163:Cep68 UTSW 11 20240539 missense probably damaging 0.99
R1869:Cep68 UTSW 11 20240217 missense probably damaging 1.00
R2023:Cep68 UTSW 11 20239888 missense probably benign
R2902:Cep68 UTSW 11 20240187 missense probably damaging 0.99
R4292:Cep68 UTSW 11 20240079 missense probably damaging 0.99
R4393:Cep68 UTSW 11 20238544 missense probably benign 0.01
R4557:Cep68 UTSW 11 20239113 intron probably benign
R4581:Cep68 UTSW 11 20239333 missense probably benign 0.02
R4647:Cep68 UTSW 11 20239349 missense probably benign 0.00
R4887:Cep68 UTSW 11 20239239 missense probably benign 0.15
R5081:Cep68 UTSW 11 20238477 missense probably damaging 0.98
R5658:Cep68 UTSW 11 20241885 critical splice donor site probably null
R6380:Cep68 UTSW 11 20230498 missense probably benign
R7444:Cep68 UTSW 11 20239438 missense probably benign 0.01
R7455:Cep68 UTSW 11 20230571 missense probably damaging 0.99
R7486:Cep68 UTSW 11 20242166 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGGCACTTCTGCTGATGAGC -3'
(R):5'- TCTCCCGAGTTGACTGTACC -3'

Sequencing Primer
(F):5'- ACATTAGTGGGTGACTTTAGAGTAC -3'
(R):5'- CGAGTTGACTGTACCCCAGG -3'
Posted On2015-01-23