Incidental Mutation 'R2901:Tspoap1'
ID261476
Institutional Source Beutler Lab
Gene Symbol Tspoap1
Ensembl Gene ENSMUSG00000034156
Gene NameTSPO associated protein 1
SynonymsBzrap1, peripheral
MMRRC Submission 040489-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2901 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87760541-87785928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87777975 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1358 (P1358L)
Ref Sequence ENSEMBL: ENSMUSP00000048063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]
Predicted Effect probably benign
Transcript: ENSMUST00000039627
AA Change: P1358L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: P1358L

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
coiled coil region 219 249 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
coiled coil region 331 519 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
SH3 652 715 1.85e-11 SMART
low complexity region 733 759 N/A INTRINSIC
FN3 784 864 3.14e0 SMART
FN3 878 951 4.81e-4 SMART
FN3 975 1062 7.16e0 SMART
low complexity region 1254 1265 N/A INTRINSIC
low complexity region 1301 1313 N/A INTRINSIC
low complexity region 1387 1401 N/A INTRINSIC
low complexity region 1455 1471 N/A INTRINSIC
SH3 1619 1683 5.4e-13 SMART
low complexity region 1721 1732 N/A INTRINSIC
SH3 1758 1821 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100644
AA Change: P1298L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: P1298L

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
low complexity region 241 249 N/A INTRINSIC
coiled coil region 271 459 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
SH3 592 655 1.85e-11 SMART
low complexity region 673 699 N/A INTRINSIC
FN3 724 804 3.14e0 SMART
FN3 818 891 4.81e-4 SMART
FN3 915 1002 7.16e0 SMART
low complexity region 1194 1205 N/A INTRINSIC
low complexity region 1241 1253 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1395 1411 N/A INTRINSIC
SH3 1559 1623 5.4e-13 SMART
low complexity region 1661 1672 N/A INTRINSIC
SH3 1698 1761 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133645
SMART Domains Protein: ENSMUSP00000117356
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
SH3 88 151 5.48e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135957
Predicted Effect probably benign
Transcript: ENSMUST00000142329
SMART Domains Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
SH3 157 221 5.4e-13 SMART
low complexity region 259 270 N/A INTRINSIC
SH3 296 359 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144502
SMART Domains Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
PDB:2CSQ|A 223 250 8e-8 PDB
Blast:SH3 231 251 5e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154758
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygous double-KO with Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T C 1: 134,390,924 L478P probably damaging Het
Abhd13 T A 8: 9,988,231 M276K probably damaging Het
Angpt4 G T 2: 151,911,339 C3F unknown Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cep192 C T 18: 67,869,441 R2236C possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Dnah7a A T 1: 53,427,872 L3611Q probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm3336 T C 8: 70,720,626 S96P possibly damaging Het
Gm9845 T A 3: 39,358,593 noncoding transcript Het
Klf12 G T 14: 99,900,146 F321L probably damaging Het
Klhl20 G T 1: 161,109,552 C84* probably null Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lpin1 T C 12: 16,553,998 K578E probably benign Het
Mrc1 A G 2: 14,328,543 H1345R possibly damaging Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Olfr1490 C T 19: 13,654,945 P167L probably damaging Het
Olfr954 T A 9: 39,461,938 I169N probably damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Ptp4a1 T C 1: 30,943,304 N142D possibly damaging Het
Simc1 G A 13: 54,541,518 probably null Het
Snai2 T C 16: 14,705,983 S4P possibly damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Stmn2 A G 3: 8,541,921 I34V probably benign Het
Ubr3 T C 2: 70,016,192 S1620P possibly damaging Het
Vps51 G A 19: 6,076,438 R95W probably damaging Het
Zufsp C T 10: 33,927,612 R492Q probably damaging Het
Zufsp T C 10: 33,928,063 T472A probably benign Het
Other mutations in Tspoap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Tspoap1 APN 11 87777821 intron probably null
IGL01718:Tspoap1 APN 11 87780255 missense possibly damaging 0.90
IGL02427:Tspoap1 APN 11 87762515 missense probably benign 0.00
IGL02487:Tspoap1 APN 11 87762516 missense possibly damaging 0.90
IGL02730:Tspoap1 APN 11 87781709 missense probably damaging 0.98
IGL02979:Tspoap1 APN 11 87770521 missense probably damaging 1.00
R0384:Tspoap1 UTSW 11 87766454 missense probably damaging 1.00
R0396:Tspoap1 UTSW 11 87776346 splice site probably benign
R0470:Tspoap1 UTSW 11 87776162 missense probably damaging 0.99
R0637:Tspoap1 UTSW 11 87777240 splice site probably benign
R0671:Tspoap1 UTSW 11 87762809 missense probably damaging 1.00
R0960:Tspoap1 UTSW 11 87770595 splice site probably benign
R0989:Tspoap1 UTSW 11 87765823 missense probably damaging 0.99
R1396:Tspoap1 UTSW 11 87766120 missense probably damaging 1.00
R1792:Tspoap1 UTSW 11 87765881 splice site probably null
R2902:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R3969:Tspoap1 UTSW 11 87762446 missense probably damaging 1.00
R4400:Tspoap1 UTSW 11 87775603 missense probably damaging 1.00
R4599:Tspoap1 UTSW 11 87779521 missense probably damaging 1.00
R4635:Tspoap1 UTSW 11 87777857 missense probably benign 0.25
R4731:Tspoap1 UTSW 11 87765647 missense probably benign 0.09
R4755:Tspoap1 UTSW 11 87771663 missense possibly damaging 0.77
R4780:Tspoap1 UTSW 11 87778443 missense possibly damaging 0.48
R4960:Tspoap1 UTSW 11 87766396 nonsense probably null
R5494:Tspoap1 UTSW 11 87775205 missense possibly damaging 0.47
R5687:Tspoap1 UTSW 11 87777126 missense probably damaging 1.00
R6200:Tspoap1 UTSW 11 87761703 missense possibly damaging 0.85
R6563:Tspoap1 UTSW 11 87777159 missense possibly damaging 0.87
R6816:Tspoap1 UTSW 11 87765665 missense probably benign
R6897:Tspoap1 UTSW 11 87765812 missense probably damaging 1.00
R7141:Tspoap1 UTSW 11 87774697 missense probably damaging 1.00
R7215:Tspoap1 UTSW 11 87770489 missense probably benign 0.02
R7341:Tspoap1 UTSW 11 87766379 missense probably damaging 1.00
R7360:Tspoap1 UTSW 11 87778521 missense probably benign 0.09
R7394:Tspoap1 UTSW 11 87766119 nonsense probably null
R7483:Tspoap1 UTSW 11 87761525 missense probably benign 0.00
R7617:Tspoap1 UTSW 11 87763625 missense probably benign 0.02
R7793:Tspoap1 UTSW 11 87764310 missense probably benign 0.00
R7814:Tspoap1 UTSW 11 87775524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGAGACTGACAGCGACG -3'
(R):5'- TAAGCTGGATTCTGGAGCAGG -3'

Sequencing Primer
(F):5'- CTGACAGCGACGAGGAGATCTTG -3'
(R):5'- AGAAGCCGGCTGCAATGTTC -3'
Posted On2015-01-23