Incidental Mutation 'R2902:Clvs1'
ID 261493
Institutional Source Beutler Lab
Gene Symbol Clvs1
Ensembl Gene ENSMUSG00000041216
Gene Name clavesin 1
Synonyms 4933402J24Rik, Rlbp1l1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2902 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 9269293-9451691 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9281972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 139 (K139E)
Ref Sequence ENSEMBL: ENSMUSP00000103985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000108348]
AlphaFold Q9D4C9
Predicted Effect probably damaging
Transcript: ENSMUST00000038841
AA Change: K139E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216
AA Change: K139E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108348
AA Change: K139E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216
AA Change: K139E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149848
Meta Mutation Damage Score 0.1941 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Clvs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Clvs1 APN 4 9281939 missense probably damaging 1.00
IGL01293:Clvs1 APN 4 9281559 start codon destroyed probably null
IGL01463:Clvs1 APN 4 9429818 missense probably benign 0.27
IGL03031:Clvs1 APN 4 9449385 splice site probably benign
R0472:Clvs1 UTSW 4 9281801 missense probably damaging 1.00
R0496:Clvs1 UTSW 4 9424241 missense probably damaging 1.00
R0848:Clvs1 UTSW 4 9282003 missense possibly damaging 0.83
R1541:Clvs1 UTSW 4 9281814 missense probably benign 0.00
R1992:Clvs1 UTSW 4 9281899 missense probably benign 0.01
R2901:Clvs1 UTSW 4 9281972 missense probably damaging 0.96
R4321:Clvs1 UTSW 4 9282029 intron probably benign
R4934:Clvs1 UTSW 4 9424216 missense possibly damaging 0.91
R4946:Clvs1 UTSW 4 9281831 nonsense probably null
R4970:Clvs1 UTSW 4 9350857 intron probably benign
R5187:Clvs1 UTSW 4 9281865 missense possibly damaging 0.53
R5327:Clvs1 UTSW 4 9424261 missense probably damaging 1.00
R5605:Clvs1 UTSW 4 9281751 missense probably damaging 0.98
R5940:Clvs1 UTSW 4 9449443 missense possibly damaging 0.96
R6818:Clvs1 UTSW 4 9282014 critical splice donor site probably null
R6857:Clvs1 UTSW 4 9449433 missense probably benign 0.00
R7692:Clvs1 UTSW 4 9350739 missense probably benign 0.23
R8247:Clvs1 UTSW 4 9281885 missense possibly damaging 0.77
R8791:Clvs1 UTSW 4 9429807 missense probably damaging 1.00
R9500:Clvs1 UTSW 4 9429834 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCAGGAAGTTTCACCAAGC -3'
(R):5'- AAAGTCCAGTGCAACTCAGAG -3'

Sequencing Primer
(F):5'- GGAAGTTTCACCAAGCCGATGC -3'
(R):5'- GTGCAACTCAGAGGCTATAGTTCTC -3'
Posted On 2015-01-23