Incidental Mutation 'R2902:AI314180'
ID261494
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58809691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1592 (T1592M)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
AA Change: T1592M

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: T1592M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149513
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTGCAACACTCCTTCAAGACAG -3'
(R):5'- AATAGCCTGTAATCTTGGTTGCTG -3'

Sequencing Primer
(F):5'- GACAGCCTGAAGAATTTCATTTGTGG -3'
(R):5'- AATCTTGGTTGCTGGTTCTTGGAC -3'
Posted On2015-01-23