Incidental Mutation 'R2902:Ssc4d'
ID261498
Institutional Source Beutler Lab
Gene Symbol Ssc4d
Ensembl Gene ENSMUSG00000029699
Gene Namescavenger receptor cysteine rich family, 4 domains
SynonymsC330016E03Rik, Srcrb4d
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135960211-135974531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135964663 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 113 (P113L)
Ref Sequence ENSEMBL: ENSMUSP00000122958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054895] [ENSMUST00000111150] [ENSMUST00000111152] [ENSMUST00000111153] [ENSMUST00000153823] [ENSMUST00000154181]
Predicted Effect probably benign
Transcript: ENSMUST00000054895
SMART Domains Protein: ENSMUSP00000050439
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 32 132 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111150
SMART Domains Protein: ENSMUSP00000106780
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 6 106 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111152
AA Change: P312L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106782
Gene: ENSMUSG00000029699
AA Change: P312L

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111153
AA Change: P312L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106783
Gene: ENSMUSG00000029699
AA Change: P312L

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153823
AA Change: P113L

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122958
Gene: ENSMUSG00000029699
AA Change: P113L

DomainStartEndE-ValueType
SR 1 101 6.78e-54 SMART
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154181
SMART Domains Protein: ENSMUSP00000123008
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154696
AA Change: P98L
SMART Domains Protein: ENSMUSP00000117071
Gene: ENSMUSG00000029699
AA Change: P98L

DomainStartEndE-ValueType
SR 2 61 5.24e-5 SMART
low complexity region 88 102 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Ssc4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Ssc4d APN 5 135967963 missense probably damaging 1.00
IGL02585:Ssc4d APN 5 135970338 missense possibly damaging 0.74
IGL02821:Ssc4d APN 5 135966069 splice site probably benign
IGL03343:Ssc4d APN 5 135961174 nonsense probably null
R2051:Ssc4d UTSW 5 135970264 missense probably benign 0.00
R2069:Ssc4d UTSW 5 135970317 missense possibly damaging 0.50
R2508:Ssc4d UTSW 5 135965607 missense probably damaging 1.00
R2901:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2939:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R3081:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R4038:Ssc4d UTSW 5 135970316 missense possibly damaging 0.50
R4181:Ssc4d UTSW 5 135961924 missense possibly damaging 0.85
R4590:Ssc4d UTSW 5 135964684 missense probably benign 0.00
R4771:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R5411:Ssc4d UTSW 5 135963400 missense probably benign 0.40
R5583:Ssc4d UTSW 5 135970196 missense probably damaging 0.99
R5662:Ssc4d UTSW 5 135960894 makesense probably null
R5681:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R6357:Ssc4d UTSW 5 135966096 missense probably benign 0.00
R6962:Ssc4d UTSW 5 135962921 critical splice donor site probably null
R7258:Ssc4d UTSW 5 135963087 missense probably damaging 1.00
R7274:Ssc4d UTSW 5 135967956 missense possibly damaging 0.66
R7360:Ssc4d UTSW 5 135966111 missense probably damaging 1.00
R7563:Ssc4d UTSW 5 135963033 missense probably damaging 1.00
Z1177:Ssc4d UTSW 5 135961066 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTCATCTGCTGCCATCTG -3'
(R):5'- CAAATTAAAGGTCAGCATTGGAGC -3'

Sequencing Primer
(F):5'- ATCTGCTGCCATCTGCTCATC -3'
(R):5'- AGGCCTGCTGGTACATACTTACAG -3'
Posted On2015-01-23