Incidental Mutation 'R2902:Gldn'
ID261510
Institutional Source Beutler Lab
Gene Symbol Gldn
Ensembl Gene ENSMUSG00000046167
Gene Namegliomedin
SynonymsCRG-L2, Crlg2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54286486-54341786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54335814 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 360 (L360P)
Ref Sequence ENSEMBL: ENSMUSP00000056080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056740
AA Change: L360P

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056080
Gene: ENSMUSG00000046167
AA Change: L360P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Collagen 136 195 8.3e-11 PFAM
low complexity region 199 211 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
OLF 299 543 1.97e-35 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele fail to form heminodes without overt neurological abnormalities or alteration in nerve conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Gldn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gldn APN 9 54338464 missense probably damaging 0.99
IGL01778:Gldn APN 9 54334492 splice site probably null
IGL02425:Gldn APN 9 54338721 missense probably damaging 1.00
R2284:Gldn UTSW 9 54286565 nonsense probably null
R3055:Gldn UTSW 9 54338523 missense probably damaging 0.96
R3683:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3684:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3733:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3734:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R4668:Gldn UTSW 9 54332018 nonsense probably null
R5228:Gldn UTSW 9 54334719 missense probably damaging 0.98
R5574:Gldn UTSW 9 54312922 missense probably damaging 1.00
R5773:Gldn UTSW 9 54334491 critical splice donor site probably null
R5926:Gldn UTSW 9 54338438 missense possibly damaging 0.68
R5943:Gldn UTSW 9 54338437 missense possibly damaging 0.81
R6331:Gldn UTSW 9 54286878 missense probably benign 0.32
R6671:Gldn UTSW 9 54338407 missense probably damaging 1.00
R6821:Gldn UTSW 9 54338770 missense probably benign 0.01
R6897:Gldn UTSW 9 54334874 splice site probably null
R7579:Gldn UTSW 9 54338364 missense probably benign 0.21
R7604:Gldn UTSW 9 54338593 missense probably benign
R7705:Gldn UTSW 9 54338692 missense probably benign 0.00
Z1177:Gldn UTSW 9 54286660 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCTGTAGCTGTCCAAACACC -3'
(R):5'- GAACACATCTAGACAATGGCAG -3'

Sequencing Primer
(F):5'- CACCAAATATTTGTTCCTGGGGCAG -3'
(R):5'- TCTAGACAATGGCAGAAGACAAC -3'
Posted On2015-01-23