Incidental Mutation 'R2902:Washc4'
ID261513
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 83554763 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 153 (Y153*)
Ref Sequence ENSEMBL: ENSMUSP00000151417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably null
Transcript: ENSMUST00000038388
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217842
AA Change: Y153*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7983:Washc4 UTSW 10 83573773 splice site probably null
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGAGCTGCATGAGTGACTG -3'
(R):5'- GTGTCTGAACATCCTAAGCATG -3'

Sequencing Primer
(F):5'- AATGACCTGGCCTGCAGGAG -3'
(R):5'- GAACATCCTAAGCATGTATACTGAG -3'
Posted On2015-01-23