Incidental Mutation 'R2902:Olfr804'
ID261516
Institutional Source Beutler Lab
Gene Symbol Olfr804
Ensembl Gene ENSMUSG00000095401
Gene Nameolfactory receptor 804
SynonymsMOR110-7, GA_x6K02T2PULF-11383575-11384519
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2902 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129703210-129710018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129705451 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 191 (H191R)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: H191R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: H191R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: H191R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G A 4: 58,809,691 T1592M probably benign Het
Apobec2 T C 17: 48,423,381 T86A probably benign Het
C1qtnf1 A G 11: 118,448,104 probably null Het
Cacng3 A G 7: 122,754,527 K78R possibly damaging Het
Cep68 A G 11: 20,240,187 L275P probably damaging Het
Chrm4 A G 2: 91,927,957 K237E probably benign Het
Clvs1 A G 4: 9,281,972 K139E probably damaging Het
Col25a1 A T 3: 130,546,391 E351V probably damaging Het
Cyp4f18 A T 8: 72,002,411 I107N probably damaging Het
Dagla A G 19: 10,248,103 L899P probably damaging Het
Dnah3 T C 7: 119,951,499 K3199R possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam186a G T 15: 99,945,168 T1065K possibly damaging Het
Ferd3l T G 12: 33,928,953 M155R probably damaging Het
Fgd4 A G 16: 16,425,865 Y602H probably damaging Het
Gldn T C 9: 54,335,814 L360P possibly damaging Het
Gm9920 C A 15: 55,112,471 probably benign Het
Inhbc T C 10: 127,357,752 T132A probably benign Het
Krt23 T C 11: 99,483,971 D260G probably damaging Het
Lrch3 G A 16: 32,950,396 A123T probably damaging Het
Mark2 A T 19: 7,283,448 S408T probably benign Het
Nme8 A T 13: 19,675,664 V23E probably benign Het
Nod2 A T 8: 88,675,463 I912F probably damaging Het
Nxpe4 A G 9: 48,394,146 I279V probably benign Het
Oas3 A G 5: 120,758,917 F880L probably damaging Het
Olfr251 T A 9: 38,378,041 N53K possibly damaging Het
Olfr993 C T 2: 85,414,052 V276M possibly damaging Het
Pcnt C T 10: 76,375,230 R2371H probably damaging Het
Prex2 A T 1: 11,208,614 N1389I possibly damaging Het
Prf1 A T 10: 61,300,319 N125Y probably damaging Het
Prr12 C T 7: 45,047,612 G960R unknown Het
Rap1b A G 10: 117,824,602 S17P probably damaging Het
Rhot2 G T 17: 25,843,976 Q63K probably damaging Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Slco1a6 A G 6: 142,096,320 L510P probably damaging Het
Ssc4d G A 5: 135,964,663 P113L possibly damaging Het
Sv2a A T 3: 96,193,756 N690I possibly damaging Het
Tbc1d24 T C 17: 24,207,246 Y452C probably benign Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Tmem82 C A 4: 141,616,464 G165V probably benign Het
Tpo T A 12: 30,119,449 T96S possibly damaging Het
Triobp A G 15: 78,973,418 E1073G possibly damaging Het
Tspoap1 C T 11: 87,777,975 P1358L probably benign Het
Usp47 A G 7: 112,093,451 Y1020C probably damaging Het
Washc4 C A 10: 83,554,763 Y153* probably null Het
Other mutations in Olfr804
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr804 APN 10 129705623 missense probably benign 0.01
IGL02041:Olfr804 APN 10 129705235 missense probably damaging 1.00
IGL02245:Olfr804 APN 10 129705739 missense probably damaging 1.00
IGL02341:Olfr804 APN 10 129705489 missense probably damaging 0.99
IGL02433:Olfr804 APN 10 129705576 missense probably benign 0.01
authen UTSW 10 129705799 missense probably benign 0.00
R0111:Olfr804 UTSW 10 129705277 missense probably damaging 1.00
R0309:Olfr804 UTSW 10 129705139 missense probably benign 0.38
R0326:Olfr804 UTSW 10 129705769 missense possibly damaging 0.69
R0374:Olfr804 UTSW 10 129705647 missense probably benign 0.00
R1573:Olfr804 UTSW 10 129705618 missense probably damaging 1.00
R1663:Olfr804 UTSW 10 129705291 missense probably benign 0.44
R1778:Olfr804 UTSW 10 129705705 missense probably benign 0.01
R1789:Olfr804 UTSW 10 129705607 missense possibly damaging 0.82
R1906:Olfr804 UTSW 10 129705496 missense probably benign 0.00
R2108:Olfr804 UTSW 10 129705621 missense probably benign
R2211:Olfr804 UTSW 10 129705451 missense probably benign
R2432:Olfr804 UTSW 10 129704925 missense possibly damaging 0.91
R4114:Olfr804 UTSW 10 129705799 missense probably benign 0.00
R5149:Olfr804 UTSW 10 129705508 missense probably benign 0.00
R5153:Olfr804 UTSW 10 129705157 missense probably benign 0.05
R5846:Olfr804 UTSW 10 129704887 missense probably damaging 0.99
R6553:Olfr804 UTSW 10 129705063 missense probably benign 0.07
R7676:Olfr804 UTSW 10 129705286 missense possibly damaging 0.63
R8161:Olfr804 UTSW 10 129704884 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCATCATGAACAGCAAAGTGTG -3'
(R):5'- ACTCTCTCCCTTGCAGATGG -3'

Sequencing Primer
(F):5'- AGTGTGCCACCAACTCGTC -3'
(R):5'- CTCCCTTGCAGATGGTTTAATATAC -3'
Posted On2015-01-23