Incidental Mutation 'R0335:Scn2a'
ID26152
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission 038544-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65682091 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 191 (W191R)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138368
Predicted Effect probably damaging
Transcript: ENSMUST00000144254
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCTTGCATCATACTGAAAGTCAGCTC -3'
(R):5'- GGGAGAATGGCATTGACACCAACTG -3'

Sequencing Primer
(F):5'- cagtggtagagaacttgcttaatatg -3'
(R):5'- ACCAACTGAGCTGCTATTGGG -3'
Posted On2013-04-16