Incidental Mutation 'R0335:Scn2a'
ID 26152
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 038544-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0335 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65512435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 191 (W191R)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138368
Predicted Effect probably damaging
Transcript: ENSMUST00000144254
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: W191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: W191R

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G T 15: 11,311,144 (GRCm39) D1134Y possibly damaging Het
Add3 A G 19: 53,225,259 (GRCm39) T460A probably benign Het
Amer3 A C 1: 34,618,381 (GRCm39) probably benign Het
Arhgap22 C T 14: 33,081,065 (GRCm39) probably benign Het
Arhgap32 T G 9: 32,171,056 (GRCm39) S1279A probably benign Het
Bcas1 G A 2: 170,260,601 (GRCm39) T26M probably damaging Het
Begain A T 12: 109,004,860 (GRCm39) F256I probably damaging Het
Bltp1 T C 3: 37,023,301 (GRCm39) V2210A probably damaging Het
Cabin1 A T 10: 75,492,883 (GRCm39) I1804N probably damaging Het
Cad G A 5: 31,231,329 (GRCm39) probably benign Het
Carmil1 G A 13: 24,257,966 (GRCm39) S762L probably damaging Het
Ccdc93 T A 1: 121,420,706 (GRCm39) L529Q probably damaging Het
Cdh12 T A 15: 21,578,635 (GRCm39) probably null Het
Cep15 A G 14: 12,301,266 (GRCm38) E124G possibly damaging Het
Clip2 T A 5: 134,564,069 (GRCm39) probably benign Het
Cmip T C 8: 118,172,105 (GRCm39) I480T probably damaging Het
Cnot1 A T 8: 96,498,628 (GRCm39) I203K probably benign Het
Col18a1 G A 10: 76,895,197 (GRCm39) P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 (GRCm39) probably benign Het
Crybg3 A T 16: 59,364,503 (GRCm39) L2373Q probably damaging Het
D130043K22Rik A T 13: 25,071,860 (GRCm39) I935F probably damaging Het
Dapl1 T A 2: 59,326,938 (GRCm39) D61E possibly damaging Het
Def6 A G 17: 28,447,043 (GRCm39) D558G possibly damaging Het
Dnah6 T C 6: 73,046,382 (GRCm39) probably benign Het
Dvl2 G A 11: 69,891,861 (GRCm39) probably benign Het
Ecd A C 14: 20,370,802 (GRCm39) V639G probably benign Het
Epg5 C T 18: 78,029,687 (GRCm39) T1350M probably benign Het
Erbb4 C A 1: 68,298,418 (GRCm39) M657I probably benign Het
Evi5 T C 5: 107,960,277 (GRCm39) R431G probably benign Het
Fbxo11 G A 17: 88,323,041 (GRCm39) A115V possibly damaging Het
Fgfr2 T C 7: 129,797,979 (GRCm39) T192A probably benign Het
Gas7 C T 11: 67,552,878 (GRCm39) A146V possibly damaging Het
Gatad2b T A 3: 90,263,489 (GRCm39) S529T probably benign Het
Gm10722 G T 9: 3,001,048 (GRCm39) Q41H probably null Het
Gm10801 G C 2: 98,494,352 (GRCm39) R143T possibly damaging Het
Gm7535 A G 17: 18,131,374 (GRCm39) probably benign Het
Gstm1 T A 3: 107,920,012 (GRCm39) N193I possibly damaging Het
Heatr5b G A 17: 79,135,375 (GRCm39) P252L probably benign Het
Hmgb1 A G 5: 148,987,441 (GRCm39) V36A probably benign Het
Hrh1 G T 6: 114,457,193 (GRCm39) W158L probably damaging Het
Ighv6-4 T C 12: 114,370,294 (GRCm39) M53V probably benign Het
Iqgap2 T A 13: 95,772,141 (GRCm39) D1346V probably damaging Het
Kcng3 A T 17: 83,895,166 (GRCm39) N433K possibly damaging Het
Kif1a T A 1: 92,980,288 (GRCm39) probably benign Het
Lctl C A 9: 64,026,169 (GRCm39) Q75K probably benign Het
Ldb3 T A 14: 34,300,608 (GRCm39) I89F possibly damaging Het
Lrrc49 A T 9: 60,584,378 (GRCm39) L156Q probably damaging Het
Mark2 G T 19: 7,259,193 (GRCm39) T83K probably benign Het
Ms4a15 A T 19: 10,957,574 (GRCm39) D170E probably damaging Het
Msantd2 A G 9: 37,434,056 (GRCm39) S99G possibly damaging Het
Nemf G T 12: 69,400,577 (GRCm39) T124N probably benign Het
Nlrp9c A T 7: 26,093,561 (GRCm39) F35I possibly damaging Het
Nwd2 A G 5: 63,962,116 (GRCm39) I567V probably benign Het
Optn C T 2: 5,028,926 (GRCm39) G526R probably damaging Het
Or11l3 T C 11: 58,516,566 (GRCm39) Y102C probably damaging Het
Or13p8 A G 4: 118,584,367 (GRCm39) I308V probably null Het
Or5v1b A C 17: 37,841,533 (GRCm39) I222L probably benign Het
Or7g16 T A 9: 18,727,290 (GRCm39) Q100L probably damaging Het
Pdk4 T C 6: 5,491,138 (GRCm39) E209G probably benign Het
Plch1 T C 3: 63,618,399 (GRCm39) Q712R probably damaging Het
Pnpla1 T A 17: 29,105,852 (GRCm39) V569E possibly damaging Het
Prkar2a A T 9: 108,596,457 (GRCm39) D134V probably damaging Het
Ptov1 T A 7: 44,514,046 (GRCm39) Q40L possibly damaging Het
Ptprq T C 10: 107,544,589 (GRCm39) I314V probably benign Het
Rabl2 T C 15: 89,468,169 (GRCm39) K66E probably damaging Het
Rnf38 A G 4: 44,152,507 (GRCm39) V19A possibly damaging Het
Sec22b T A 3: 97,828,572 (GRCm39) F212I possibly damaging Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Septin2 T C 1: 93,423,321 (GRCm39) S51P probably damaging Het
Serpinb1a T C 13: 33,032,639 (GRCm39) N90S probably damaging Het
Slc1a2 C T 2: 102,574,208 (GRCm39) T206I probably benign Het
Slc25a19 C A 11: 115,515,032 (GRCm39) R42L probably damaging Het
St14 G A 9: 31,002,620 (GRCm39) probably benign Het
Stxbp1 C T 2: 32,692,917 (GRCm39) probably benign Het
Tas2r131 C T 6: 132,934,792 (GRCm39) V6I probably benign Het
Tdo2 T A 3: 81,871,307 (GRCm39) M235L probably benign Het
Tenm3 T G 8: 48,685,140 (GRCm39) H2432P probably damaging Het
Tmprss15 C T 16: 78,821,630 (GRCm39) probably benign Het
Tmx1 A G 12: 70,500,030 (GRCm39) N30D probably benign Het
Tom1 A G 8: 75,791,020 (GRCm39) probably null Het
Top2a T C 11: 98,913,781 (GRCm39) N20S probably benign Het
Ttc23l T A 15: 10,540,049 (GRCm39) T145S probably benign Het
Unc13b T A 4: 43,236,983 (GRCm39) M3351K possibly damaging Het
Vmn1r47 T C 6: 89,999,641 (GRCm39) S258P probably damaging Het
Vmn2r8 T G 5: 108,945,317 (GRCm39) probably null Het
Vps11 T C 9: 44,265,135 (GRCm39) Q641R probably null Het
Wapl T A 14: 34,414,281 (GRCm39) I381N probably damaging Het
Zmym6 G A 4: 127,016,601 (GRCm39) G794E probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCTTGCATCATACTGAAAGTCAGCTC -3'
(R):5'- GGGAGAATGGCATTGACACCAACTG -3'

Sequencing Primer
(F):5'- cagtggtagagaacttgcttaatatg -3'
(R):5'- ACCAACTGAGCTGCTATTGGG -3'
Posted On 2013-04-16