Mutagenetix > Incidental Mutations

Incidental Mutation 'R2903:Grik3'

261545

Institutional Source

Beutler Lab

Gene Symbol

Grik3

Ensembl Gene

ENSMUSG00000001985

Gene Name

glutamate receptor, ionotropic, kainate 3

Synonyms

Glur7, Glur-7

MMRRC Submission

040490-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R2903 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125490700-125714173 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125670644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 473 (L473Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030676]

AlphaFold

B1AS29

Predicted Effect

probably damaging
Transcript: ENSMUST00000030676
AA Change: L473Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: L473Q

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	55	398	7.8e-72	PFAM
PBPe	435	802	4.38e-133	SMART
Lig_chan-Glu_bd	445	509	5.77e-34	SMART
transmembrane domain	823	845	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230112D13Rik	A	T	14: 34,511,941	V131E	unknown	Het
AI314180	A	G	4: 58,828,622	V937A	possibly damaging	Het
Ccnk	T	C	12: 108,202,388		probably benign	Het
Cd276	A	G	9: 58,537,320	F123L	probably benign	Het
Ddr2	T	A	1: 169,998,161	N290I	probably damaging	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gpt	A	G	15: 76,698,466	D37G	probably damaging	Het
Hsp90b1	A	C	10: 86,703,485	I90S	probably damaging	Het
Ing5	G	A	1: 93,803,988		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kdr	T	C	5: 75,966,409	Y307C	probably damaging	Het
Olfr574	A	T	7: 102,949,454	M320L	probably benign	Het
Rapgef5	A	G	12: 117,714,119	K161R	probably damaging	Het
Rassf10	A	T	7: 112,954,549	D119V	possibly damaging	Het
Samhd1	A	T	2: 157,123,415	F160Y	possibly damaging	Het
Sh3bp2	T	A	5: 34,543,556	C34*	probably null	Het
Six3	A	G	17: 85,623,855	E313G	probably damaging	Het
Tas2r118	A	G	6: 23,969,802	F87L	possibly damaging	Het
Tmem131	A	G	1: 36,825,297	L591P	probably damaging	Het
Trav17	A	C	14: 53,806,666	S10R	probably benign	Het
Ttc26	T	C	6: 38,401,102	V283A	possibly damaging	Het
Ttll3	T	C	6: 113,407,323	F534S	probably damaging	Het
Umodl1	T	A	17: 30,992,173	V890E	probably damaging	Het
Uso1	G	A	5: 92,195,435		probably null	Het
Utrn	A	G	10: 12,643,428	I2260T	probably damaging	Het
Vav1	A	G	17: 57,306,187	N620D	probably benign	Het

Other mutations in Grik3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Grik3	APN	4	125632415	missense	probably benign
IGL01534:Grik3	APN	4	125686190	missense	probably damaging	1.00
IGL01538:Grik3	APN	4	125694036	missense	possibly damaging	0.90
IGL02276:Grik3	APN	4	125623502	missense	possibly damaging	0.86
IGL02323:Grik3	APN	4	125685990	splice site	probably benign
IGL02475:Grik3	APN	4	125650517	missense	probably benign
IGL03198:Grik3	APN	4	125659762	missense	probably benign	0.25
IGL03307:Grik3	APN	4	125641554	missense	possibly damaging	0.91
R0054:Grik3	UTSW	4	125623575	missense	probably damaging	1.00
R0054:Grik3	UTSW	4	125623575	missense	probably damaging	1.00
R0116:Grik3	UTSW	4	125670556	missense	probably benign	0.01
R0208:Grik3	UTSW	4	125686165	missense	probably damaging	1.00
R0497:Grik3	UTSW	4	125623510	missense	possibly damaging	0.82
R1295:Grik3	UTSW	4	125704564	splice site	probably benign
R1296:Grik3	UTSW	4	125704564	splice site	probably benign
R1515:Grik3	UTSW	4	125670728	missense	probably benign	0.37
R1559:Grik3	UTSW	4	125707997	missense	probably benign	0.16
R1617:Grik3	UTSW	4	125691192	missense	probably benign
R1848:Grik3	UTSW	4	125694138	missense	probably damaging	1.00
R3440:Grik3	UTSW	4	125693970	missense	probably damaging	1.00
R3440:Grik3	UTSW	4	125693971	missense	probably damaging	1.00
R3442:Grik3	UTSW	4	125693970	missense	probably damaging	1.00
R3442:Grik3	UTSW	4	125693971	missense	probably damaging	1.00
R3842:Grik3	UTSW	4	125693954	splice site	probably benign
R4649:Grik3	UTSW	4	125650485	missense	probably damaging	1.00
R4841:Grik3	UTSW	4	125691176	missense	probably damaging	1.00
R4842:Grik3	UTSW	4	125691176	missense	probably damaging	1.00
R5093:Grik3	UTSW	4	125670589	missense	probably benign
R5318:Grik3	UTSW	4	125694136	missense	probably damaging	0.96
R5549:Grik3	UTSW	4	125686045	missense	possibly damaging	0.95
R6221:Grik3	UTSW	4	125705123	missense	probably damaging	0.99
R6226:Grik3	UTSW	4	125659789	missense	probably benign	0.04
R6306:Grik3	UTSW	4	125632412	missense	probably benign	0.01
R6672:Grik3	UTSW	4	125623516	missense	probably benign	0.08
R6682:Grik3	UTSW	4	125650466	missense	probably damaging	1.00
R6783:Grik3	UTSW	4	125632300	missense	probably benign	0.01
R7390:Grik3	UTSW	4	125649739	missense	probably damaging	1.00
R7604:Grik3	UTSW	4	125623635	missense	probably damaging	0.97
R7790:Grik3	UTSW	4	125686019	missense	probably damaging	1.00
R7822:Grik3	UTSW	4	125656397	critical splice donor site	probably null
R7952:Grik3	UTSW	4	125704547	missense	probably damaging	1.00
R8418:Grik3	UTSW	4	125686042	missense	possibly damaging	0.95
R8769:Grik3	UTSW	4	125656373	missense	probably damaging	1.00
R9030:Grik3	UTSW	4	125632392	missense	probably benign	0.24
R9243:Grik3	UTSW	4	125707897	missense	probably benign	0.00
Z1177:Grik3	UTSW	4	125650506	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CGTGCACACATATGCCCATG -3'
(R):5'- TAGAACCGTCCACCCTGTTC -3'

Sequencing Primer
(F):5'- AGGTCAAGGTCATGCTTAACTGC -3'
(R):5'- ACCCTGTTCCCATCCCAC -3'

Posted On

2015-01-23