Incidental Mutation 'R2903:Ttll3'
ID261551
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission 040490-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2903 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113407323 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 534 (F534S)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000205017]
Predicted Effect probably damaging
Transcript: ENSMUST00000032414
AA Change: F534S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: F534S

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038889
AA Change: F535S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: F535S

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203524
AA Change: F381S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204255
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik A T 14: 34,511,941 V131E unknown Het
AI314180 A G 4: 58,828,622 V937A possibly damaging Het
Ccnk T C 12: 108,202,388 probably benign Het
Cd276 A G 9: 58,537,320 F123L probably benign Het
Ddr2 T A 1: 169,998,161 N290I probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gpt A G 15: 76,698,466 D37G probably damaging Het
Grik3 T A 4: 125,670,644 L473Q probably damaging Het
Hsp90b1 A C 10: 86,703,485 I90S probably damaging Het
Ing5 G A 1: 93,803,988 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Olfr574 A T 7: 102,949,454 M320L probably benign Het
Rapgef5 A G 12: 117,714,119 K161R probably damaging Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Sh3bp2 T A 5: 34,543,556 C34* probably null Het
Six3 A G 17: 85,623,855 E313G probably damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Tmem131 A G 1: 36,825,297 L591P probably damaging Het
Trav17 A C 14: 53,806,666 S10R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Umodl1 T A 17: 30,992,173 V890E probably damaging Het
Uso1 G A 5: 92,195,435 probably null Het
Utrn A G 10: 12,643,428 I2260T probably damaging Het
Vav1 A G 17: 57,306,187 N620D probably benign Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTCTGACCACAGCCTG -3'
(R):5'- AGTCTGTGGTCTGAAATCTAGCC -3'

Sequencing Primer
(F):5'- GAGCTCTTGGTCCCTGACTG -3'
(R):5'- CTAGCCTGGATCTAAGAGTTCACTG -3'
Posted On2015-01-23