Incidental Mutation 'R2903:Umodl1'
ID 261564
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 040490-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2903 (G1)
Quality Score 128
Status Not validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31211147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 890 (V890E)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: V890E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V890E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000066981
AA Change: V775E
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V775E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: V890E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V890E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik A T 14: 34,233,898 (GRCm39) V131E unknown Het
Ccnk T C 12: 108,168,647 (GRCm39) probably benign Het
Cd276 A G 9: 58,444,603 (GRCm39) F123L probably benign Het
Ddr2 T A 1: 169,825,730 (GRCm39) N290I probably damaging Het
Ecpas A G 4: 58,828,622 (GRCm39) V937A possibly damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gpt A G 15: 76,582,666 (GRCm39) D37G probably damaging Het
Grik3 T A 4: 125,564,437 (GRCm39) L473Q probably damaging Het
Hsp90b1 A C 10: 86,539,349 (GRCm39) I90S probably damaging Het
Ift56 T C 6: 38,378,037 (GRCm39) V283A possibly damaging Het
Ing5 G A 1: 93,731,710 (GRCm39) probably benign Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kdr T C 5: 76,127,069 (GRCm39) Y307C probably damaging Het
Or51t4 A T 7: 102,598,661 (GRCm39) M320L probably benign Het
Rapgef5 A G 12: 117,677,854 (GRCm39) K161R probably damaging Het
Rassf10 A T 7: 112,553,756 (GRCm39) D119V possibly damaging Het
Samhd1 A T 2: 156,965,335 (GRCm39) F160Y possibly damaging Het
Sh3bp2 T A 5: 34,700,900 (GRCm39) C34* probably null Het
Six3 A G 17: 85,931,283 (GRCm39) E313G probably damaging Het
Tas2r118 A G 6: 23,969,801 (GRCm39) F87L possibly damaging Het
Tmem131 A G 1: 36,864,378 (GRCm39) L591P probably damaging Het
Trav17 A C 14: 54,044,123 (GRCm39) S10R probably benign Het
Ttll3 T C 6: 113,384,284 (GRCm39) F534S probably damaging Het
Uso1 G A 5: 92,343,294 (GRCm39) probably null Het
Utrn A G 10: 12,519,172 (GRCm39) I2260T probably damaging Het
Vav1 A G 17: 57,613,187 (GRCm39) N620D probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCAGAAATTACCAGG -3'
(R):5'- GAATCCCCATGAAGAGGCTCAG -3'

Sequencing Primer
(F):5'- CCAGGAGCATCTATTCTTAGGAC -3'
(R):5'- GAAGAGGCTCAGAGCACATCTTCC -3'
Posted On 2015-01-23