Incidental Mutation 'R2903:Six3'
ID261566
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
MMRRC Submission 040490-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2903 (G1)
Quality Score193
Status Not validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85623855 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect probably damaging
Transcript: ENSMUST00000162695
AA Change: E313G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175898
AA Change: E313G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176081
AA Change: E313G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188560
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik A T 14: 34,511,941 V131E unknown Het
AI314180 A G 4: 58,828,622 V937A possibly damaging Het
Ccnk T C 12: 108,202,388 probably benign Het
Cd276 A G 9: 58,537,320 F123L probably benign Het
Ddr2 T A 1: 169,998,161 N290I probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gpt A G 15: 76,698,466 D37G probably damaging Het
Grik3 T A 4: 125,670,644 L473Q probably damaging Het
Hsp90b1 A C 10: 86,703,485 I90S probably damaging Het
Ing5 G A 1: 93,803,988 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Olfr574 A T 7: 102,949,454 M320L probably benign Het
Rapgef5 A G 12: 117,714,119 K161R probably damaging Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Sh3bp2 T A 5: 34,543,556 C34* probably null Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Tmem131 A G 1: 36,825,297 L591P probably damaging Het
Trav17 A C 14: 53,806,666 S10R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ttll3 T C 6: 113,407,323 F534S probably damaging Het
Umodl1 T A 17: 30,992,173 V890E probably damaging Het
Uso1 G A 5: 92,195,435 probably null Het
Utrn A G 10: 12,643,428 I2260T probably damaging Het
Vav1 A G 17: 57,306,187 N620D probably benign Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2916:Six3 UTSW 17 85621633 missense probably benign 0.25
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
R6524:Six3 UTSW 17 85621970 missense probably damaging 1.00
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF012:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF022:Six3 UTSW 17 85621356 small insertion probably benign
RF054:Six3 UTSW 17 85621355 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACACAGAGCCCCGTTGAAG -3'
(R):5'- CTTTCTGCCCGCAACATCAG -3'

Sequencing Primer
(F):5'- AGCCCCGTTGAAGGCTGTG -3'
(R):5'- GCAACATCAGCGTTTGTGAC -3'
Posted On2015-01-23