Incidental Mutation 'R2904:Gak'
ID261574
Institutional Source Beutler Lab
Gene Symbol Gak
Ensembl Gene ENSMUSG00000062234
Gene Namecyclin G associated kinase
SynonymsD130045N16Rik
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108569411-108629755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108624214 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 79 (N79S)
Ref Sequence ENSEMBL: ENSMUSP00000118713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048] [ENSMUST00000199662]
Predicted Effect probably benign
Transcript: ENSMUST00000046603
AA Change: N79S

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: N79S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 313 1.6e-49 PFAM
Pfam:Pkinase_Tyr 40 313 3e-30 PFAM
PTEN_C2 568 707 1.43e-44 SMART
low complexity region 819 833 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
DnaJ 1240 1301 2.3e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135225
AA Change: N79S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234
AA Change: N79S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137872
Predicted Effect possibly damaging
Transcript: ENSMUST00000145467
AA Change: N79S

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234
AA Change: N79S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145935
Predicted Effect probably benign
Transcript: ENSMUST00000199048
SMART Domains Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
PDB:4O38|B 23 69 3e-10 PDB
SCOP:d1koba_ 41 69 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199662
SMART Domains Protein: ENSMUSP00000143646
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Trim21 A G 7: 102,559,971 W282R probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Gak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Gak APN 5 108613634 makesense probably null
IGL00768:Gak APN 5 108576654 missense probably benign
IGL01128:Gak APN 5 108592370 missense probably damaging 0.97
IGL01557:Gak APN 5 108584337 missense probably damaging 1.00
IGL02559:Gak APN 5 108584232 missense probably null 0.07
PIT4449001:Gak UTSW 5 108580925 missense probably benign 0.00
R0030:Gak UTSW 5 108613547 nonsense probably null
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1530:Gak UTSW 5 108624193 missense probably damaging 0.97
R1646:Gak UTSW 5 108602854 missense probably damaging 1.00
R1699:Gak UTSW 5 108604377 nonsense probably null
R1702:Gak UTSW 5 108606376 splice site probably null
R1732:Gak UTSW 5 108576582 missense probably benign 0.28
R1738:Gak UTSW 5 108616976 missense probably damaging 1.00
R1772:Gak UTSW 5 108606892 missense probably damaging 1.00
R1792:Gak UTSW 5 108585531 nonsense probably null
R2068:Gak UTSW 5 108570225 missense probably benign
R2137:Gak UTSW 5 108606877 splice site probably null
R2138:Gak UTSW 5 108606877 splice site probably null
R2139:Gak UTSW 5 108606877 splice site probably null
R3080:Gak UTSW 5 108613602 missense possibly damaging 0.90
R3773:Gak UTSW 5 108582672 missense probably benign 0.00
R4523:Gak UTSW 5 108576566 missense probably benign 0.22
R4665:Gak UTSW 5 108582960 missense probably benign
R4703:Gak UTSW 5 108569877 missense probably damaging 0.99
R4890:Gak UTSW 5 108580876 unclassified probably benign
R4951:Gak UTSW 5 108582718 missense probably benign
R4971:Gak UTSW 5 108596806 missense probably damaging 1.00
R5328:Gak UTSW 5 108617001 missense possibly damaging 0.94
R5436:Gak UTSW 5 108592352 missense possibly damaging 0.94
R5496:Gak UTSW 5 108576617 missense probably benign 0.00
R6207:Gak UTSW 5 108625029 critical splice donor site probably null
R6359:Gak UTSW 5 108571900 missense probably damaging 1.00
R6468:Gak UTSW 5 108623336 nonsense probably null
R6682:Gak UTSW 5 108598876 missense probably damaging 1.00
R6915:Gak UTSW 5 108602950 missense probably benign 0.20
R7403:Gak UTSW 5 108613535 missense probably benign 0.00
R7458:Gak UTSW 5 108583074 missense probably benign 0.00
R7522:Gak UTSW 5 108591199 missense possibly damaging 0.95
R7650:Gak UTSW 5 108584295 missense probably benign 0.00
X0064:Gak UTSW 5 108613533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGACAAAGTGGGACTCTC -3'
(R):5'- TCCTGAGGTTCTGTGAGATCAG -3'

Sequencing Primer
(F):5'- CCAACCTATCTGTTTAGCATGGAGAC -3'
(R):5'- GATGGTCTGATCCAGGTAAATGG -3'
Posted On2015-01-23